View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2465_low_13 (Length: 337)
Name: NF2465_low_13
Description: NF2465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2465_low_13 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 101; Significance: 5e-50; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 101; E-Value: 5e-50
Query Start/End: Original strand, 181 - 337
Target Start/End: Original strand, 21288386 - 21288540
Alignment:
| Q |
181 |
aaagcatgtcgcttttttattcaaagaaagaaaaaataaaactgctgnnnnnnnnnatgacgactaaaaacaaatttcactatattatagagatgaaaaa |
280 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| || || ||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
21288386 |
aaagcatgtcgcttttttactcaaagaaagaaaaaataaaactgttggtttttt--ataacgactaaaaacaaattccaccatattatagagatgaaaaa |
21288483 |
T |
 |
| Q |
281 |
cttaattaacccaataattaatgaaacaagaactaaaatttgctcgttttatatggc |
337 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
21288484 |
cttaattaacccaataattaatgaaacaaaaactaaaatttgctcgttttatatggc |
21288540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University