View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2465_low_15 (Length: 333)
Name: NF2465_low_15
Description: NF2465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2465_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 8e-92; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 8e-92
Query Start/End: Original strand, 41 - 282
Target Start/End: Complemental strand, 33976363 - 33976133
Alignment:
| Q |
41 |
gtaccatccgtttgtactctgtacctaaaatctttgagaagaaggccaatatattttgcattgcattttgcatgagaaatacta---ttttatattgtag |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||| ||| || |
|
|
| T |
33976363 |
gtaccatccgtttgtactctgtacctaaaatctttgagaagaaggccaatat--tttgcattgcattttgcatgagaaatactactattttattttggag |
33976266 |
T |
 |
| Q |
138 |
tagtaaaatacgtatgacattatatactattgatgcagtactaattagaaaacaaataacccttccattattcctcttcaacctttgatttgtgaaatca |
237 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33976265 |
ta------------tgacattatatactattgatgcagtactaattagaaaacaaataacccttccattattcctcttcaacctttgatttgtgaaatca |
33976178 |
T |
 |
| Q |
238 |
ttagaaacttaaacacatctttcatccatattttacatatactca |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33976177 |
ttagaaacttaaacacatctttcatccatattttacatatactca |
33976133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 300 - 333
Target Start/End: Complemental strand, 33976130 - 33976097
Alignment:
| Q |
300 |
tataactttgttcgtcttcctttcataaataaaa |
333 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
33976130 |
tataactttgttcgtcttcctttcataaaaaaaa |
33976097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University