View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2465_low_24 (Length: 253)

Name: NF2465_low_24
Description: NF2465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2465_low_24
NF2465_low_24
[»] chr3 (1 HSPs)
chr3 (1-206)||(36576328-36576534)


Alignment Details
Target: chr3 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 1 - 206
Target Start/End: Complemental strand, 36576534 - 36576328
Alignment:
1 cataaagcacttctgattcggatactgtaaaatgcaactatctagagatatcatcaaattcgttgaaaatcttaacaataaatgcattgtgggtatgggt 100  Q
    |||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||    
36576534 cataaagcacttctgatttggatactataaaatgcaactatctagagatatcatcaaattcgttgaaaatcttaacaataaatgcattttgagtatgggt 36576435  T
101 gaacacaaggctaatcatcactgagttgaggggtgacatagtattactttattttgataacaggtgacatgggattactgccca-atccacatcgccccc 199  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| || |||||||||||||||    
36576434 gaacacaaggctaattatcactgagttgaggggtgacatagtattactctattttgataacaggtgacatgggattactgcacacatccacatcgccccc 36576335  T
200 attgcta 206  Q
    |||||||    
36576334 attgcta 36576328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University