View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2465_low_5 (Length: 442)
Name: NF2465_low_5
Description: NF2465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2465_low_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 100; Significance: 3e-49; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 100; E-Value: 3e-49
Query Start/End: Original strand, 122 - 229
Target Start/End: Complemental strand, 28756837 - 28756730
Alignment:
| Q |
122 |
atgatcgcaatattttcccagtaaccaccacactggaatttgtgccgccttgcccgaattagtggtgttggaatatatgcctctgttatggaatcatgcg |
221 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28756837 |
atgatcgcaatattttcccagtaaccaccgcactggaatttgtgccgccttgccggaattagtggtgttggaatatatgcctctgttatggaatcatgcg |
28756738 |
T |
 |
| Q |
222 |
gtttctac |
229 |
Q |
| |
|
|||||||| |
|
|
| T |
28756737 |
gtttctac |
28756730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 296 - 382
Target Start/End: Complemental strand, 28756664 - 28756577
Alignment:
| Q |
296 |
cccctcacgtatccattatctgcaattttg-tagaaagataacatggtaattttgggttaataaacatttatctccctgtagtataat |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||||||||||||| || |||||| |
|
|
| T |
28756664 |
cccctcacgtatccattatctgcaattttggtagaaagataacatagtaattttgggttaatagacatttatctccctctaatataat |
28756577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University