View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2466R-Insertion-5 (Length: 124)

Name: NF2466R-Insertion-5
Description: NF2466R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2466R-Insertion-5
NF2466R-Insertion-5
[»] chr7 (1 HSPs)
chr7 (12-121)||(38014172-38014281)


Alignment Details
Target: chr7 (Bit Score: 102; Significance: 4e-51; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 102; E-Value: 4e-51
Query Start/End: Original strand, 12 - 121
Target Start/End: Complemental strand, 38014281 - 38014172
Alignment:
12 ataacacctactacactcgagcgtctactcactagcagcaatatggatcacactcaatgggaaacagcttataacttcctaaaaatgtagttgttttggg 111  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
38014281 ataacacctactacactcgagcgtctactcactatcagcaatatggatcacactcaatgggaaacagcttataacttcctaaaaatgcagttgttttggg 38014182  T
112 tgtgaaccgg 121  Q
    ||||||||||    
38014181 tgtgaaccgg 38014172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University