View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2466R-Insertion-5 (Length: 124)
Name: NF2466R-Insertion-5
Description: NF2466R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2466R-Insertion-5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 102; Significance: 4e-51; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 102; E-Value: 4e-51
Query Start/End: Original strand, 12 - 121
Target Start/End: Complemental strand, 38014281 - 38014172
Alignment:
| Q |
12 |
ataacacctactacactcgagcgtctactcactagcagcaatatggatcacactcaatgggaaacagcttataacttcctaaaaatgtagttgttttggg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
38014281 |
ataacacctactacactcgagcgtctactcactatcagcaatatggatcacactcaatgggaaacagcttataacttcctaaaaatgcagttgttttggg |
38014182 |
T |
|
| Q |
112 |
tgtgaaccgg |
121 |
Q |
| |
|
|||||||||| |
|
|
| T |
38014181 |
tgtgaaccgg |
38014172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University