View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2466R-Insertion-6 (Length: 149)
Name: NF2466R-Insertion-6
Description: NF2466R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2466R-Insertion-6 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 137; Significance: 7e-72; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 137; E-Value: 7e-72
Query Start/End: Original strand, 9 - 149
Target Start/End: Complemental strand, 24266843 - 24266703
Alignment:
| Q |
9 |
ggtttttggttatggctttggttgatttggttcagattaagttgggaactttggcttgtgggagtcattttactttggctgctgttgctcctttgctttt |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
24266843 |
ggtttttggttatggctttggttgatttggttcagattaagttgggaactttggcttgtgggagtcattatactttggctgctgttgctcctttgctttt |
24266744 |
T |
|
| Q |
109 |
tcttgttcctactgcgttacttatctatgttattcttgtcc |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24266743 |
tcttgttcctactgcgttacttatctatgttattcttgtcc |
24266703 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University