View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2466_high_2 (Length: 413)
Name: NF2466_high_2
Description: NF2466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2466_high_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 379; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 379; E-Value: 0
Query Start/End: Original strand, 17 - 403
Target Start/End: Complemental strand, 9496988 - 9496602
Alignment:
| Q |
17 |
aagataaagatgcacttgttgcagaacagctccgtaactcgggaggttgcaaaggtaaggtaacatccggctgtataattaaacacccacaatgaacacc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9496988 |
aagataaagatgcacttgttgcagaacagctccgtaactcgggaggttgcagaggtaaggtaacatccggctgtataattaaacacccacaatgaacacc |
9496889 |
T |
 |
| Q |
117 |
aacatatatgtatctagtaggacttaagcaacaatctttcttacatgttcctggtcacgtgctatctgtgacattgcaatcaggcggtcctgcagcaagg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9496888 |
aacatatatgtatctagtaggacttaagcaacaatctttcttacatgttcctggtcacgtgctatctgtgacattgcaatcaggcggtcctgcagcaagg |
9496789 |
T |
 |
| Q |
217 |
cagcaggtaaaggttggatcagaggctgtactgcaatgtttttacctctccaagaaggccacacaacttcagcaccatccattcttaaacaaccatcctc |
316 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9496788 |
cagcaggtaaaggttgaatcagaggctgtactgcaatgtttttacctctccaagaaggccacacaacttcagcaccatccattcttaaacaaccatcctc |
9496689 |
T |
 |
| Q |
317 |
taaattacttccatcatgataccagcctctcattccccagtgtcttgggctggaactaccagacctaacagttggaaaacccctttg |
403 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9496688 |
taaattacttccatcatgataccagcctctcattccccagtgtcttgggctggaactaccagacctaacagttggaaaacccctttg |
9496602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University