View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2467-Insertion-7 (Length: 193)
Name: NF2467-Insertion-7
Description: NF2467
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2467-Insertion-7 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 8 - 193
Target Start/End: Original strand, 2225150 - 2225342
Alignment:
| Q |
8 |
gcttttgcatgaagaaatagttttttccaaccaagtccataatttcatataattattgcaatcttaatagctaagtctctgta--------taagcacaa |
99 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
2225150 |
gcttttgcatgaagagatagttttt-ccaaccaagtccacaatttcatataattattgcaatcttaatagctaagtctctgtagcatgcagtaagcacaa |
2225248 |
T |
|
| Q |
100 |
tgatatgaacctttatgagagttgtagtcttgtaggctggacttattagagatcacactcactttgcaaaaaagtgattgattccttttgtgtt |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2225249 |
tgatatgaacctttatgagagttgtagtcttgtaggctggacttattagagatcactctcactttgcaaaaaagtgattgattccttttgtgtt |
2225342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University