View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2467-Insertion-8 (Length: 157)
Name: NF2467-Insertion-8
Description: NF2467
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2467-Insertion-8 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 129; Significance: 4e-67; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 129; E-Value: 4e-67
Query Start/End: Original strand, 8 - 157
Target Start/End: Original strand, 3342563 - 3342712
Alignment:
| Q |
8 |
ggaagtaattctaaattcttttgatatgaaatcaagtacgtgtttatatacaggcgattggtcaannnnnnnaaaagctggatttatttatcaagtgact |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
3342563 |
ggaagtaattctaaattcttttgatatgaaatcaagtacgtgtttatatacaggcgattggtcaatttttttaaaagctggatttatttatcaagtgact |
3342662 |
T |
 |
| Q |
108 |
cttgaatcttgatgtatagctaatattatactacatgttttggaacatta |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3342663 |
cttgaatcttgatgtatagctaatattatactacatgttttggaacatta |
3342712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University