View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2467-Insertion-9 (Length: 131)
Name: NF2467-Insertion-9
Description: NF2467
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2467-Insertion-9 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 97; Significance: 4e-48; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 97; E-Value: 4e-48
Query Start/End: Original strand, 8 - 131
Target Start/End: Complemental strand, 30759167 - 30759041
Alignment:
| Q |
8 |
aaagaatcatcaaagaaagagtttattgcggtcaattccaaccgaccgtgctccaaatgaatctaaatcctt---gtggttgaagagcccatggtggggg |
104 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||||| |||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
30759167 |
aaagaatcatcaaacaaagagattattgcggtcaattctaaccgaccatgctccaaatgaatctaaatccttcaagtggttgaagagcccatggtggggg |
30759068 |
T |
|
| Q |
105 |
tatgaactattttatttttgcattgta |
131 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
30759067 |
tatgaactattttatttttgcattgta |
30759041 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000004
Query Start/End: Original strand, 58 - 122
Target Start/End: Complemental strand, 37708918 - 37708851
Alignment:
| Q |
58 |
ctccaaatgaatctaaatcctt---gtggttgaagagcccatggtgggggtatgaactattttatttt |
122 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| | |||| || |||||||||||| |||| |
|
|
| T |
37708918 |
ctccaaatgaatctaaatccttatggtggttgaagagcctactgtggaggcatgaactattttttttt |
37708851 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University