View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2467R-Insertion-9 (Length: 341)
Name: NF2467R-Insertion-9
Description: NF2467R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2467R-Insertion-9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 140; Significance: 3e-73; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 103 - 258
Target Start/End: Original strand, 20760971 - 20761125
Alignment:
| Q |
103 |
gtttctatgtgaatgcatgtgtgtgataattcatttaacttttatacatatttttcagaagtgccaaaaatatattgcctaattaattttggtttctcat |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
20760971 |
gtttctatgtgaatgcatgtgtgtgataattcatttaacttttatacatatttttc-gaagtgtcaaaaatagattgcctaattaattttggtttctcat |
20761069 |
T |
|
| Q |
203 |
aatattctattccagccttgctatatggtacgaaatatatgtgcacgacttgcaca |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20761070 |
aatattctattccagccttgctatatggtacgaaatatatgtgcacgacttgcaca |
20761125 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 168 - 212
Target Start/End: Original strand, 20760685 - 20760730
Alignment:
| Q |
168 |
aaaaatatattgcctaattaattttgg-tttctcataatattctat |
212 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||||| |||||||| |
|
|
| T |
20760685 |
aaaaatatattgcccaattaattttggttttctcatagtattctat |
20760730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 309 - 341
Target Start/End: Original strand, 20761176 - 20761208
Alignment:
| Q |
309 |
gcacggcctaaatctgatggttattgtatatga |
341 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |
|
|
| T |
20761176 |
gcacagcctaaatctgatggttattgtatatga |
20761208 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University