View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2467_low_10 (Length: 320)
Name: NF2467_low_10
Description: NF2467
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2467_low_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 143; Significance: 4e-75; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 88 - 238
Target Start/End: Original strand, 21566299 - 21566449
Alignment:
| Q |
88 |
agacacgacgacattctagtaatattataggcaatattaaatgttttgtagcaactgatagttgacactatcagattaaactattattaaatttattttt |
187 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21566299 |
agacacgacgacatgctagtaatattataggcaatattaaatgttttgtagcaactgatagttgacactatcagattaaactattattaaatttattttt |
21566398 |
T |
 |
| Q |
188 |
aagtaatgcaacaataaataaagccaataatcaactgatagtcacaggttc |
238 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21566399 |
aagtaatacaacaataaataaagccaataatcaactgatagtcacaggttc |
21566449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University