View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2467_low_11 (Length: 315)
Name: NF2467_low_11
Description: NF2467
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2467_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 139 - 181
Target Start/End: Complemental strand, 28251671 - 28251629
Alignment:
| Q |
139 |
ctttaactcccactcttccacttcacttcccacactcaaacca |
181 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
28251671 |
ctttaactcccactcttccacttcactttccacactcaaacca |
28251629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University