View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2467_low_11 (Length: 315)

Name: NF2467_low_11
Description: NF2467
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2467_low_11
NF2467_low_11
[»] chr7 (1 HSPs)
chr7 (139-181)||(28251629-28251671)


Alignment Details
Target: chr7 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 139 - 181
Target Start/End: Complemental strand, 28251671 - 28251629
Alignment:
139 ctttaactcccactcttccacttcacttcccacactcaaacca 181  Q
    |||||||||||||||||||||||||||| ||||||||||||||    
28251671 ctttaactcccactcttccacttcactttccacactcaaacca 28251629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University