View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2467_low_12 (Length: 298)
Name: NF2467_low_12
Description: NF2467
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2467_low_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 5e-99; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 29 - 236
Target Start/End: Complemental strand, 51872836 - 51872629
Alignment:
| Q |
29 |
acaagttcggtcttatccttaggatggatggatttatttgctttaatggnnnnnnnatagccgtcaaatcaatgacacagttttgatttgaccgtgatgg |
128 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51872836 |
acaagttcggtcttatcctttggatggatggatttatttgctttaatggtttttttatagccgtcaaatcaatgacacagttttgatttgaccgtgatgg |
51872737 |
T |
|
| Q |
129 |
cccaaaccaaatacctagctagtggatttgtatgtggataataatattttaaaacaccacacgtttggcttgatttccgttatgtatgaaacataacgaa |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51872736 |
cccaaaccaaatacctagctagtggatttgtatgtggataataatattttaaaacaccacacgtttggcttgatttccgttatgtatgaaacataacgaa |
51872637 |
T |
|
| Q |
229 |
ttttatcc |
236 |
Q |
| |
|
|||||||| |
|
|
| T |
51872636 |
ttttatcc |
51872629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 251 - 288
Target Start/End: Complemental strand, 51872630 - 51872592
Alignment:
| Q |
251 |
cccgagtggaaggaaaaaa-taaagtgatgatatattat |
288 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
51872630 |
cccgagtggaaggaaaaaaataaagtgatgatatattat |
51872592 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University