View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2467_low_14 (Length: 273)
Name: NF2467_low_14
Description: NF2467
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2467_low_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 3 - 237
Target Start/End: Original strand, 8871123 - 8871357
Alignment:
| Q |
3 |
cagatcaagtacagatcgaagtgaatgaaatgaacggcgaagatttacctggatttccagcggcggaggatttaggaccatcgacaatggcaaacggtgc |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
8871123 |
cagatcaagtacagatcgaagtgaatgaaatgaacggcgaagatttacctggatttccagcggcggaggatttaggaccatcgacaatggcgaacggtgc |
8871222 |
T |
 |
| Q |
103 |
ttggagaacggagggaagacggagtttgtgatcgacacggctgttttggacttcgctgtagacggaggcgaagcgtgttgtgacggtgggagtgacggtg |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8871223 |
ttggagaacggagggaagacggagtttgtgatcgacacggctgttttggacttcgctgtagacggaggcgaagcgtgttgtgacggtgggagtgacggtg |
8871322 |
T |
 |
| Q |
203 |
gtggtgccgttagttacgattgcagctggtgccat |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
8871323 |
gtggtgccgttagttacgattgcagctggtgccat |
8871357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University