View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2467_low_22 (Length: 206)
Name: NF2467_low_22
Description: NF2467
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2467_low_22 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 98 - 206
Target Start/End: Original strand, 41431588 - 41431696
Alignment:
| Q |
98 |
catagctattgaaatggttggtctagttcctgtcttatcgaaagggtgttggatttctttacaatacatccttattgaatagtgccataggttgtgttca |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41431588 |
catagctattgaaatggttggtctagttcctgtcttatcgaaagggtgttggatttctttacaatacatccttattgaatagtgccataggttgtgttca |
41431687 |
T |
 |
| Q |
198 |
ctccgtata |
206 |
Q |
| |
|
|||| |||| |
|
|
| T |
41431688 |
ctccatata |
41431696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 102 - 142
Target Start/End: Original strand, 33369868 - 33369908
Alignment:
| Q |
102 |
gctattgaaatggttggtctagttcctgtcttatcgaaagg |
142 |
Q |
| |
|
|||||||||||||| |||||||||| |||||||||| |||| |
|
|
| T |
33369868 |
gctattgaaatggtaggtctagttcatgtcttatcggaagg |
33369908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University