View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2467_low_3 (Length: 543)
Name: NF2467_low_3
Description: NF2467
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2467_low_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 141; Significance: 1e-73; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 141; E-Value: 1e-73
Query Start/End: Original strand, 322 - 533
Target Start/End: Complemental strand, 32869151 - 32868938
Alignment:
| Q |
322 |
ctaggaagatgaaattgggtggtggctatgttccagcactctgtttgtttgaaaatcttaannnnnnnnnnctt--ctagatttaaggtatggcttctaa |
419 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||| || ||||||||||||||||| |||||| |
|
|
| T |
32869151 |
ctaggaagatgaaattgggtggtggctatgttccagctctttgtttgtttgaaaatcttaaatttgttttttttttctagatttaaggtatgggttctaa |
32869052 |
T |
|
| Q |
420 |
agttatgttcatcaggtcactgatttgttggatgcaccccactatctggattcaacaagtctagaatgttcgcctgatgtggcttaaaaaggctacatgc |
519 |
Q |
| |
|
| || ||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32869051 |
aattttgttcatcagggcgctgatttgttggatgcaccccactatctggattcaacaagtctagaatgttcgcctgatgtggcttaaaaaggctacatgc |
32868952 |
T |
|
| Q |
520 |
gtagatgctctgtg |
533 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
32868951 |
gtagatgctctgtg |
32868938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 203 - 287
Target Start/End: Complemental strand, 32869271 - 32869186
Alignment:
| Q |
203 |
tgtttgtttggaggtctctatgtgtgggtttgctg-tgtttttcggcggcttccggcaaactgggttgcaggtctcccacatgctt |
287 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32869271 |
tgtttgtttggaggcctctatgtgtgggtttgctggtgtttttcggcggcttccggcaaactgggttgcaggtctcccacatgctt |
32869186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 71; E-Value: 7e-32
Query Start/End: Original strand, 33 - 111
Target Start/End: Complemental strand, 32869380 - 32869302
Alignment:
| Q |
33 |
tctagccttatcattctgtgacttctctctaaccaaacacaaaccttctccaccaccttacacaatcatgtccttcggc |
111 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32869380 |
tctagccttatcattctccgacttctctctaaccaaacacaaaccttctccaccaccttacacaatcatgtccttcggc |
32869302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 33 - 93
Target Start/End: Complemental strand, 45597456 - 45597396
Alignment:
| Q |
33 |
tctagccttatcattctgtgacttctctctaaccaaacacaaaccttctccaccaccttac |
93 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
45597456 |
tctagccttatcgatctccgacttctctctaaccaaacacaaatcttctccaccgccttac |
45597396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 58 - 101
Target Start/End: Original strand, 29535226 - 29535269
Alignment:
| Q |
58 |
tctctaaccaaacacaaaccttctccaccaccttacacaatcat |
101 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
29535226 |
tctctaaccaaatacaaaccttctccaccaccttactcaatcat |
29535269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University