View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2468_low_6 (Length: 238)
Name: NF2468_low_6
Description: NF2468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2468_low_6 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 18 - 238
Target Start/End: Complemental strand, 38436427 - 38436210
Alignment:
| Q |
18 |
gcttccttgtcttataataactgatttcaaatactactgaatctaaactactttcgattctaacttatacgattgtttaattttcgtcccagacaaaatg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38436427 |
gcttccttgtcttataataactgatttcaaatactattgaatctaaacta---tcgattctaacttatacgattgtttaattttcgtcccagacaaaatg |
38436331 |
T |
 |
| Q |
118 |
aggaagaaggtggatgaacgtatcagaactcttatcgaaaatggcgtcaaatcaaggcatcgatccatgtttgtcattatcggtgacaaatcccgtgatc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38436330 |
aggaagaaggtggatgaacgtatcagaactcttatcgaaaatggcgtcaaatcaaggcatcgatccatgtttgtcattatcggtgacaaatcccgtgatc |
38436231 |
T |
 |
| Q |
218 |
aggtatcgttttatacatatt |
238 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
38436230 |
aggtatcgttttatacatatt |
38436210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 115 - 206
Target Start/End: Complemental strand, 10311993 - 10311902
Alignment:
| Q |
115 |
atgaggaagaaggtggatgaacgtatcagaactcttatcgaaaatggcgtcaaatcaaggcatcgatccatgtttgtcattatcggtgacaa |
206 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||| || || |||||||| ||| |||||||| | |||||||||||||| || |||||||| |
|
|
| T |
10311993 |
atgaggaagaaggtggatgagcgaatcagaactctcattgagaatggcgttaaaacaaggcataggtccatgtttgtcatcattggtgacaa |
10311902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University