View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2468_low_7 (Length: 231)
Name: NF2468_low_7
Description: NF2468
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2468_low_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 111 - 213
Target Start/End: Original strand, 25016118 - 25016220
Alignment:
| Q |
111 |
ttaagatggactcactcttcctaagccaaggtagtgagcaacaatggcagcaggaatggcagggaagagaatggacagcttggtaccaagaataacctct |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25016118 |
ttaagatggactcactcttcctaagccaaggtagtgagcaacaatggcagcaggaatggcagggaagagaatggacagcttggtaccaagaataacctct |
25016217 |
T |
 |
| Q |
211 |
tgg |
213 |
Q |
| |
|
||| |
|
|
| T |
25016218 |
tgg |
25016220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University