View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2469_low_3 (Length: 299)
Name: NF2469_low_3
Description: NF2469
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2469_low_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 19 - 284
Target Start/End: Original strand, 29595962 - 29596228
Alignment:
| Q |
19 |
atgttgtagtatgtgtttgattcccgaattttcttacatcaaacacgcgactaacaaaccactaattgtgataattgcgaagctagtatttgatgcttcg |
118 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||||||||| |||||| ||||||||| |||| |||||||||||||||||||| ||||||| |
|
|
| T |
29595962 |
atgttttagtatgtgtttgattcccgaatcttcttacatcaaacacgcgtctaacataccactaatcgtgaaaattgcgaagctagtatttggtgcttcg |
29596061 |
T |
 |
| Q |
119 |
aaaaaccgcgcgtctgcagagccccaccgtggatccaaacagacttgtagtataagannnnnnnactagtaagtagataagtgtgttgatcatgaatatg |
218 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||| |
|
|
| T |
29596062 |
aaaaaccgcgtgtctgcatagccccaccgtggatccaaacagacttgtagtataagatttttttactagtaagtagataagtgtgttgatcatgaacatg |
29596161 |
T |
 |
| Q |
219 |
agatgcgccgtcatgtgttgtattcaaacatgc-caagcagtttgttgcctactcatttcatctgtg |
284 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
29596162 |
agatgcgccgtcatgtgttgtattctaacatgctcaagcagtttgttgcctactcatttcatctgtg |
29596228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University