View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2470_high_11 (Length: 214)
Name: NF2470_high_11
Description: NF2470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2470_high_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 67; Significance: 6e-30; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 71 - 196
Target Start/End: Original strand, 26411346 - 26411472
Alignment:
| Q |
71 |
agaagaatttccagatgaaaagttgttcgc-attagagaaagaccatggtttactgatatgacaaacttcaaagcagcaggtgagattccagaagtttac |
169 |
Q |
| |
|
||||||||||||||||||||| |||||| | || ||| ||| |||||| ||| |||| |||||||||| ||||| |||||||||||||||| ||| |||| |
|
|
| T |
26411346 |
agaagaatttccagatgaaaaattgttcaccatgagaaaaacaccatgatttgctgacatgacaaactacaaagtagcaggtgagattccaaaagattac |
26411445 |
T |
 |
| Q |
170 |
aattgggaacaaagacataaattcctc |
196 |
Q |
| |
|
||| ||||||||||||||||||||||| |
|
|
| T |
26411446 |
aatcgggaacaaagacataaattcctc |
26411472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 18 - 76
Target Start/End: Original strand, 26406498 - 26406556
Alignment:
| Q |
18 |
catttgtcaagattggcgaataacgaagccactaacaaggaaaaagaaatataagaaga |
76 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
26406498 |
catttgtcaagattggcgaataacgaagccactaacaaagaaaaagaaatataagaaga |
26406556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University