View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2470_low_10 (Length: 232)
Name: NF2470_low_10
Description: NF2470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2470_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 12 - 216
Target Start/End: Complemental strand, 44420089 - 44419886
Alignment:
| Q |
12 |
aacctgtgtgaatgaaagaaaatgaagaagnnnnnnnnctaatgagtagaaaagtacatcaggactcgagaaccaaatcaactactagaaatatgacgga |
111 |
Q |
| |
|
||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44420089 |
aacctgtgtaaatgaaagaaaatgaagaa-aaaaaaaactaatgagtagaaaagtacatcaggactcgagaaccaaatcaactactagaaatatgacgga |
44419991 |
T |
 |
| Q |
112 |
cttgtcgatttattcactagatgtaccaaaattgaataacctacatctttataccataaatttatgcatgcatgctaaattttcatgagtgaaacatcta |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44419990 |
cttgtcgatttattcactagatgtaccaaaattgaataacctacatctttataccataaatttatgcatgcatgctaaattttcatgagtgaaacatcta |
44419891 |
T |
 |
| Q |
212 |
aaaag |
216 |
Q |
| |
|
||||| |
|
|
| T |
44419890 |
aaaag |
44419886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University