View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2470_low_10 (Length: 232)

Name: NF2470_low_10
Description: NF2470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2470_low_10
NF2470_low_10
[»] chr3 (1 HSPs)
chr3 (12-216)||(44419886-44420089)


Alignment Details
Target: chr3 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 12 - 216
Target Start/End: Complemental strand, 44420089 - 44419886
Alignment:
12 aacctgtgtgaatgaaagaaaatgaagaagnnnnnnnnctaatgagtagaaaagtacatcaggactcgagaaccaaatcaactactagaaatatgacgga 111  Q
    ||||||||| |||||||||||||||||||         ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44420089 aacctgtgtaaatgaaagaaaatgaagaa-aaaaaaaactaatgagtagaaaagtacatcaggactcgagaaccaaatcaactactagaaatatgacgga 44419991  T
112 cttgtcgatttattcactagatgtaccaaaattgaataacctacatctttataccataaatttatgcatgcatgctaaattttcatgagtgaaacatcta 211  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44419990 cttgtcgatttattcactagatgtaccaaaattgaataacctacatctttataccataaatttatgcatgcatgctaaattttcatgagtgaaacatcta 44419891  T
212 aaaag 216  Q
    |||||    
44419890 aaaag 44419886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University