View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2470_low_6 (Length: 336)
Name: NF2470_low_6
Description: NF2470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2470_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 20 - 329
Target Start/End: Original strand, 25131687 - 25131996
Alignment:
| Q |
20 |
tttactgataggattaagaactctctttgatcttctttggagtggaatatgttctttcgtaaatgctttttctatagcatgttaatcctacggtaggttt |
119 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
25131687 |
tttactgatagaattaagaactctctttgatcttctttggagtggaatatgttctttcgtaaatgctttttctatagcatgttaatcctatggtaggttt |
25131786 |
T |
|
| Q |
120 |
catgattttaaaatttctttagatattgcttgctaaaatattacgtcctgcagaaaatatttcatttaaagtttctttttcacttccattcctctttgtt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
25131787 |
catgattttaaaatttctttagatattgtttgctaaaatattacgtcctgcagaaaatatttcatttgaagtttctttttcacttccattcctctttgtt |
25131886 |
T |
|
| Q |
220 |
tggcttcagtggctgtataaactgacaggtattttggaactttattggcttcacttccattccccttcccttctgttttgcttcacttcttgttagggca |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25131887 |
tggcttcagtggctgtataaactgacaggtcttttggaactttattggcttcacttccattccccttcccttctgttttgcttcacttcttgttagggca |
25131986 |
T |
|
| Q |
320 |
tatccctttg |
329 |
Q |
| |
|
|||||||||| |
|
|
| T |
25131987 |
tatccctttg |
25131996 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University