View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2470_low_7 (Length: 255)

Name: NF2470_low_7
Description: NF2470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2470_low_7
NF2470_low_7
[»] chr4 (62 HSPs)
chr4 (19-243)||(52950097-52950322)
chr4 (19-117)||(53599075-53599173)
chr4 (19-117)||(55921049-55921147)
chr4 (19-116)||(7246645-7246742)
chr4 (20-117)||(38166043-38166140)
chr4 (21-116)||(42722576-42722671)
chr4 (19-117)||(16450315-16450413)
chr4 (31-117)||(38168284-38168369)
chr4 (19-116)||(29895802-29895899)
chr4 (30-115)||(40780861-40780946)
chr4 (30-117)||(17080069-17080156)
chr4 (31-117)||(4738645-4738731)
chr4 (19-117)||(38075448-38075546)
chr4 (19-117)||(47078473-47078571)
chr4 (31-116)||(2559334-2559419)
chr4 (19-116)||(14124031-14124128)
chr4 (19-115)||(13073553-13073649)
chr4 (19-114)||(295534-295628)
chr4 (19-110)||(8889037-8889128)
chr4 (20-116)||(31588700-31588798)
chr4 (19-117)||(20421788-20421886)
chr4 (19-117)||(36145213-36145311)
chr4 (19-116)||(30317248-30317345)
chr4 (19-116)||(43458628-43458725)
chr4 (19-116)||(43468362-43468459)
chr4 (25-117)||(3159467-3159559)
chr4 (21-117)||(49260663-49260759)
chr4 (33-116)||(49952144-49952228)
chr4 (58-117)||(25406561-25406620)
chr4 (19-117)||(10541031-10541128)
chr4 (19-117)||(48015071-48015169)
chr4 (19-88)||(1446841-1446910)
chr4 (20-117)||(5472846-5472943)
chr4 (30-117)||(47682380-47682467)
chr4 (19-117)||(24166465-24166563)
chr4 (24-117)||(18531539-18531632)
chr4 (19-113)||(1940779-1940870)
chr4 (41-117)||(14597898-14597974)
chr4 (36-116)||(15839934-15840014)
chr4 (19-115)||(33647736-33647832)
chr4 (30-106)||(40272340-40272416)
chr4 (33-116)||(2686454-2686537)
chr4 (41-116)||(14567276-14567351)
chr4 (22-117)||(14858729-14858823)
chr4 (37-115)||(6032643-6032721)
chr4 (19-117)||(20128324-20128422)
chr4 (32-106)||(20354665-20354739)
chr4 (19-116)||(8064797-8064894)
chr4 (32-117)||(16645146-16645231)
chr4 (31-76)||(20532448-20532493)
chr4 (30-83)||(26479981-26480034)
chr4 (30-107)||(46108717-46108794)
chr4 (31-115)||(14859318-14859402)
chr4 (30-114)||(21429327-21429411)
chr4 (29-117)||(36262765-36262853)
chr4 (72-116)||(45721154-45721198)
chr4 (31-111)||(48317279-48317359)
chr4 (32-104)||(53354560-53354632)
chr4 (19-105)||(3507286-3507371)
chr4 (31-117)||(21192667-21192753)
chr4 (40-78)||(33109360-33109398)
chr4 (29-109)||(52209637-52209717)
[»] scaffold0291 (1 HSPs)
scaffold0291 (19-117)||(6868-6966)
[»] chr6 (41 HSPs)
chr6 (19-117)||(5253221-5253319)
chr6 (19-117)||(21898662-21898760)
chr6 (19-117)||(8932675-8932773)
chr6 (19-117)||(8944141-8944239)
chr6 (19-117)||(3601098-3601196)
chr6 (32-117)||(9633623-9633708)
chr6 (20-117)||(19089513-19089610)
chr6 (19-117)||(3587943-3588041)
chr6 (19-117)||(6606095-6606193)
chr6 (19-117)||(12606444-12606542)
chr6 (19-116)||(8938725-8938822)
chr6 (32-111)||(2271307-2271386)
chr6 (30-117)||(13036002-13036089)
chr6 (30-117)||(29444763-29444850)
chr6 (31-117)||(8611972-8612058)
chr6 (31-117)||(30788851-30788937)
chr6 (19-117)||(34954617-34954715)
chr6 (61-117)||(21167431-21167487)
chr6 (21-117)||(31129193-31129289)
chr6 (30-116)||(29333138-29333224)
chr6 (31-117)||(30410471-30410557)
chr6 (19-116)||(9179735-9179832)
chr6 (20-117)||(12635829-12635926)
chr6 (52-117)||(14783418-14783483)
chr6 (21-117)||(13468949-13469045)
chr6 (32-117)||(13584444-13584533)
chr6 (19-111)||(17114901-17114993)
chr6 (30-117)||(10311467-10311554)
chr6 (29-100)||(19230574-19230645)
chr6 (19-117)||(5029831-5029929)
chr6 (53-115)||(8149797-8149859)
chr6 (19-117)||(14107356-14107454)
chr6 (33-96)||(8888910-8888973)
chr6 (30-109)||(21945314-21945392)
chr6 (21-116)||(24671865-24671960)
chr6 (72-117)||(13116128-13116173)
chr6 (31-91)||(5333030-5333090)
chr6 (30-78)||(9366460-9366508)
chr6 (19-115)||(11142617-11142713)
chr6 (53-117)||(14326045-14326109)
chr6 (53-117)||(14419055-14419119)
[»] chr5 (56 HSPs)
chr5 (19-117)||(1538442-1538540)
chr5 (19-117)||(9805015-9805113)
chr5 (19-117)||(40117426-40117524)
chr5 (19-117)||(42086338-42086436)
chr5 (20-117)||(19572736-19572833)
chr5 (20-117)||(20682615-20682712)
chr5 (19-117)||(5731918-5732016)
chr5 (19-117)||(23383668-23383766)
chr5 (30-117)||(13664282-13664369)
chr5 (34-117)||(14728109-14728192)
chr5 (20-115)||(42291505-42291600)
chr5 (30-116)||(11845800-11845886)
chr5 (33-117)||(42861216-42861300)
chr5 (30-117)||(41800999-41801086)
chr5 (31-117)||(7866604-7866690)
chr5 (31-117)||(9812895-9812981)
chr5 (19-117)||(41163458-41163555)
chr5 (19-96)||(7308383-7308460)
chr5 (19-116)||(25417182-25417279)
chr5 (19-115)||(20525849-20525945)
chr5 (32-104)||(24875369-24875441)
chr5 (18-117)||(9168251-9168349)
chr5 (30-117)||(39099777-39099864)
chr5 (19-117)||(8513530-8513628)
chr5 (31-117)||(12705037-12705123)
chr5 (31-117)||(12766154-12766240)
chr5 (19-93)||(26077152-26077226)
chr5 (35-117)||(27484188-27484270)
chr5 (30-115)||(37263262-37263347)
chr5 (20-116)||(20692945-20693041)
chr5 (63-115)||(40060339-40060391)
chr5 (58-117)||(28857196-28857255)
chr5 (30-117)||(38897717-38897804)
chr5 (30-117)||(43399150-43399237)
chr5 (30-116)||(2485218-2485304)
chr5 (19-117)||(12081919-12082017)
chr5 (19-117)||(23247350-23247447)
chr5 (31-116)||(14588616-14588701)
chr5 (32-117)||(20255393-20255478)
chr5 (30-106)||(18294493-18294569)
chr5 (61-117)||(28857002-28857058)
chr5 (19-74)||(28857139-28857194)
chr5 (30-117)||(38369721-38369808)
chr5 (19-117)||(14152061-14152159)
chr5 (32-117)||(3653912-3653997)
chr5 (19-117)||(18136274-18136376)
chr5 (30-78)||(20590021-20590069)
chr5 (29-117)||(21375372-21375460)
chr5 (61-117)||(36783296-36783352)
chr5 (30-117)||(30349601-30349688)
chr5 (30-92)||(14974347-14974409)
chr5 (19-56)||(1899012-1899049)
chr5 (36-117)||(24499010-24499091)
chr5 (32-117)||(24653810-24653894)
chr5 (31-80)||(25467433-25467482)
chr5 (30-66)||(35403561-35403597)
[»] chr7 (53 HSPs)
chr7 (19-116)||(38578866-38578963)
chr7 (21-117)||(13095873-13095969)
chr7 (19-114)||(18785682-18785777)
chr7 (19-117)||(17748380-17748478)
chr7 (19-117)||(43861970-43862068)
chr7 (19-117)||(48804696-48804794)
chr7 (31-117)||(22993365-22993451)
chr7 (23-117)||(39420854-39420948)
chr7 (19-116)||(27028292-27028389)
chr7 (19-117)||(1797473-1797571)
chr7 (19-117)||(10047874-10047972)
chr7 (30-116)||(37514945-37515031)
chr7 (19-117)||(47341889-47341987)
chr7 (32-117)||(48551883-48551968)
chr7 (31-107)||(19914711-19914787)
chr7 (29-116)||(41945496-41945583)
chr7 (19-117)||(1605954-1606052)
chr7 (30-116)||(22573836-22573922)
chr7 (19-117)||(22973980-22974078)
chr7 (19-115)||(26423288-26423383)
chr7 (41-116)||(3353459-3353534)
chr7 (30-117)||(28744186-28744273)
chr7 (30-117)||(39474964-39475051)
chr7 (20-111)||(45960007-45960098)
chr7 (46-116)||(3603397-3603467)
chr7 (31-117)||(4195200-4195286)
chr7 (134-200)||(6453977-6454043)
chr7 (31-117)||(14650342-14650428)
chr7 (19-117)||(29151953-29152051)
chr7 (19-117)||(42210260-42210358)
chr7 (19-117)||(43925525-43925623)
chr7 (29-117)||(24969324-24969412)
chr7 (19-115)||(27875088-27875184)
chr7 (30-117)||(8734684-8734771)
chr7 (30-117)||(34659250-34659337)
chr7 (19-98)||(36619271-36619350)
chr7 (30-116)||(20247169-20247255)
chr7 (19-117)||(23658192-23658290)
chr7 (30-116)||(29805439-29805525)
chr7 (19-117)||(32823256-32823354)
chr7 (19-117)||(42032109-42032207)
chr7 (19-117)||(49142667-49142765)
chr7 (32-93)||(30827318-30827379)
chr7 (21-109)||(28396166-28396254)
chr7 (51-117)||(24983416-24983483)
chr7 (58-117)||(48244354-48244413)
chr7 (31-117)||(5069813-5069899)
chr7 (19-117)||(10317744-10317841)
chr7 (40-113)||(38988934-38989006)
chr7 (31-111)||(5039422-5039502)
chr7 (135-191)||(6464724-6464780)
chr7 (53-117)||(32768984-32769048)
chr7 (132-200)||(44943065-44943133)
[»] chr2 (52 HSPs)
chr2 (20-111)||(10669603-10669694)
chr2 (19-117)||(25540402-25540500)
chr2 (19-117)||(41220645-41220743)
chr2 (31-116)||(38962785-38962870)
chr2 (19-98)||(45263684-45263763)
chr2 (31-117)||(7747296-7747382)
chr2 (19-117)||(16325605-16325703)
chr2 (31-117)||(20116610-20116696)
chr2 (19-117)||(22593145-22593241)
chr2 (19-116)||(2550878-2550975)
chr2 (20-117)||(10823071-10823168)
chr2 (19-106)||(331511-331598)
chr2 (30-117)||(34346285-34346372)
chr2 (30-117)||(37560194-37560281)
chr2 (19-110)||(39201513-39201604)
chr2 (31-117)||(3643885-3643971)
chr2 (19-117)||(3811689-3811787)
chr2 (19-117)||(5035298-5035396)
chr2 (19-117)||(8410141-8410239)
chr2 (19-117)||(12455320-12455418)
chr2 (30-116)||(14169608-14169694)
chr2 (19-117)||(18902528-18902626)
chr2 (19-117)||(38005412-38005510)
chr2 (19-117)||(44139494-44139592)
chr2 (19-116)||(6358150-6358247)
chr2 (21-117)||(42770649-42770745)
chr2 (19-114)||(34356216-34356311)
chr2 (19-105)||(10026626-10026712)
chr2 (30-116)||(33005772-33005858)
chr2 (19-117)||(34722690-34722788)
chr2 (19-116)||(12864234-12864331)
chr2 (28-115)||(20612534-20612622)
chr2 (33-116)||(3848913-3848996)
chr2 (30-117)||(24179589-24179676)
chr2 (33-116)||(44773287-44773370)
chr2 (19-117)||(29422225-29422323)
chr2 (30-116)||(35946759-35946845)
chr2 (20-117)||(44945605-44945701)
chr2 (41-116)||(18649025-18649100)
chr2 (19-117)||(2528339-2528437)
chr2 (30-116)||(16813164-16813250)
chr2 (30-116)||(16852443-16852529)
chr2 (27-116)||(9360747-9360836)
chr2 (31-116)||(16034959-16035044)
chr2 (19-116)||(21286454-21286551)
chr2 (19-111)||(7787066-7787158)
chr2 (30-117)||(31596430-31596517)
chr2 (32-69)||(13104871-13104908)
chr2 (31-116)||(27725962-27726047)
chr2 (30-115)||(43303292-43303377)
chr2 (51-115)||(21641992-21642056)
chr2 (61-117)||(44023347-44023403)
[»] chr3 (63 HSPs)
chr3 (19-117)||(7650237-7650335)
chr3 (19-117)||(47219154-47219252)
chr3 (31-116)||(54261248-54261333)
chr3 (19-115)||(53649737-53649833)
chr3 (20-115)||(3507534-3507629)
chr3 (19-117)||(28572210-28572308)
chr3 (19-117)||(29135923-29136021)
chr3 (19-116)||(45877464-45877561)
chr3 (19-117)||(31072888-31072986)
chr3 (19-117)||(51060280-51060378)
chr3 (20-117)||(55069678-55069775)
chr3 (33-117)||(25294984-25295068)
chr3 (30-117)||(23511588-23511675)
chr3 (19-117)||(7328854-7328951)
chr3 (30-112)||(10040577-10040659)
chr3 (19-117)||(26043822-26043920)
chr3 (19-117)||(30045831-30045929)
chr3 (19-116)||(35315966-35316063)
chr3 (31-111)||(40660332-40660412)
chr3 (21-117)||(48342032-48342128)
chr3 (19-103)||(52364813-52364897)
chr3 (30-117)||(3136693-3136780)
chr3 (19-117)||(29127929-29128027)
chr3 (19-117)||(33251672-33251770)
chr3 (51-117)||(44064586-44064652)
chr3 (19-105)||(45402362-45402448)
chr3 (30-116)||(45450447-45450533)
chr3 (20-117)||(26361966-26362063)
chr3 (19-116)||(29762155-29762252)
chr3 (19-116)||(47471842-47471938)
chr3 (32-117)||(54237471-54237556)
chr3 (19-115)||(6462422-6462518)
chr3 (20-116)||(10855395-10855490)
chr3 (45-117)||(49021202-49021274)
chr3 (19-92)||(3755580-3755653)
chr3 (31-116)||(22909805-22909890)
chr3 (19-88)||(49198361-49198430)
chr3 (33-117)||(2668085-2668169)
chr3 (31-115)||(34662320-34662404)
chr3 (21-117)||(41630511-41630607)
chr3 (33-116)||(37319889-37319972)
chr3 (19-78)||(39849082-39849140)
chr3 (33-115)||(2029268-2029350)
chr3 (31-117)||(15320208-15320294)
chr3 (21-114)||(8362589-8362682)
chr3 (20-117)||(13893937-13894034)
chr3 (31-116)||(19146983-19147068)
chr3 (30-111)||(33688972-33689053)
chr3 (19-88)||(42412802-42412871)
chr3 (33-117)||(24506647-24506731)
chr3 (53-117)||(29195318-29195382)
chr3 (19-111)||(50405608-50405700)
chr3 (19-115)||(51682955-51683051)
chr3 (31-94)||(3763072-3763135)
chr3 (19-114)||(4638164-4638259)
chr3 (19-78)||(26207839-26207898)
chr3 (19-98)||(40944893-40944971)
chr3 (19-117)||(928610-928708)
chr3 (30-116)||(13367445-13367531)
chr3 (71-117)||(21325126-21325172)
chr3 (60-117)||(36043673-36043730)
chr3 (53-117)||(10043726-10043790)
chr3 (33-117)||(35998570-35998654)
[»] chr8 (37 HSPs)
chr8 (19-115)||(4479296-4479391)
chr8 (31-117)||(10927632-10927718)
chr8 (19-117)||(45521183-45521280)
chr8 (19-91)||(1013001-1013073)
chr8 (19-117)||(6100486-6100584)
chr8 (19-117)||(43032915-43033013)
chr8 (31-116)||(68097-68182)
chr8 (29-117)||(583836-583924)
chr8 (26-117)||(11298265-11298356)
chr8 (19-117)||(2467116-2467214)
chr8 (19-117)||(43027319-43027417)
chr8 (30-116)||(44893277-44893363)
chr8 (19-115)||(15884556-15884651)
chr8 (32-116)||(23895595-23895679)
chr8 (30-117)||(8997542-8997629)
chr8 (31-117)||(2964102-2964188)
chr8 (19-116)||(18374024-18374121)
chr8 (21-117)||(26570940-26571036)
chr8 (30-117)||(10535402-10535489)
chr8 (30-117)||(16291201-16291288)
chr8 (19-117)||(8141116-8141214)
chr8 (33-109)||(24938568-24938644)
chr8 (21-76)||(8586978-8587033)
chr8 (19-66)||(38922463-38922510)
chr8 (31-117)||(3418511-3418597)
chr8 (19-117)||(16893951-16894047)
chr8 (26-92)||(22958791-22958857)
chr8 (19-117)||(24837256-24837354)
chr8 (30-116)||(36662429-36662515)
chr8 (36-117)||(3692864-3692945)
chr8 (30-111)||(11785940-11786021)
chr8 (19-78)||(6042835-6042894)
chr8 (30-117)||(14846600-14846687)
chr8 (31-117)||(22212513-22212600)
chr8 (19-117)||(14666069-14666167)
chr8 (19-117)||(27975905-27976003)
chr8 (19-117)||(28033174-28033272)
[»] scaffold0016 (1 HSPs)
scaffold0016 (19-117)||(8699-8797)
[»] chr1 (57 HSPs)
chr1 (19-117)||(5855533-5855631)
chr1 (19-117)||(17642003-17642101)
chr1 (19-117)||(18915878-18915976)
chr1 (19-117)||(26325823-26325921)
chr1 (19-117)||(49078125-49078223)
chr1 (30-106)||(14254278-14254354)
chr1 (22-117)||(8764005-8764100)
chr1 (33-116)||(14357780-14357863)
chr1 (19-117)||(9659178-9659275)
chr1 (19-117)||(41663855-41663953)
chr1 (31-117)||(45361881-45361967)
chr1 (32-117)||(10172970-10173055)
chr1 (21-117)||(43959820-43959916)
chr1 (30-117)||(32142845-32142932)
chr1 (34-117)||(37339846-37339929)
chr1 (30-96)||(10336538-10336604)
chr1 (31-117)||(10422811-10422897)
chr1 (19-117)||(30927726-30927824)
chr1 (31-116)||(16263568-16263653)
chr1 (30-117)||(34697357-34697444)
chr1 (19-117)||(15238105-15238203)
chr1 (35-117)||(33498838-33498920)
chr1 (19-117)||(35211171-35211269)
chr1 (40-117)||(4581681-4581758)
chr1 (33-116)||(5504056-5504139)
chr1 (30-117)||(11397888-11397975)
chr1 (46-117)||(26660176-26660246)
chr1 (41-116)||(45726433-45726508)
chr1 (20-117)||(12036742-12036840)
chr1 (30-116)||(18649352-18649438)
chr1 (19-117)||(32150921-32151019)
chr1 (19-117)||(34719787-34719885)
chr1 (19-116)||(21849205-21849301)
chr1 (32-116)||(50371834-50371918)
chr1 (30-117)||(5143153-5143239)
chr1 (33-116)||(19195391-19195469)
chr1 (19-106)||(33418125-33418212)
chr1 (30-117)||(50094926-50095013)
chr1 (19-117)||(32882-32980)
chr1 (19-117)||(2980930-2981028)
chr1 (39-117)||(18708539-18708617)
chr1 (34-116)||(26258721-26258803)
chr1 (32-117)||(44969688-44969773)
chr1 (32-117)||(46929737-46929822)
chr1 (21-117)||(18808278-18808374)
chr1 (19-66)||(6563452-6563499)
chr1 (30-117)||(12744522-12744609)
chr1 (30-117)||(12755512-12755599)
chr1 (19-78)||(48798108-48798167)
chr1 (19-117)||(15465976-15466074)
chr1 (33-83)||(17988693-17988743)
chr1 (63-117)||(51437512-51437566)
chr1 (63-116)||(8905163-8905216)
chr1 (20-117)||(28416958-28417055)
chr1 (19-116)||(31576547-31576644)
chr1 (19-116)||(33004015-33004112)
chr1 (85-117)||(40702591-40702623)
[»] scaffold0001 (1 HSPs)
scaffold0001 (30-117)||(65150-65237)
[»] scaffold0010 (2 HSPs)
scaffold0010 (19-117)||(155709-155807)
scaffold0010 (19-115)||(25784-25880)
[»] scaffold0376 (1 HSPs)
scaffold0376 (31-116)||(12695-12780)
[»] scaffold0209 (1 HSPs)
scaffold0209 (29-117)||(12596-12684)
[»] scaffold0223 (1 HSPs)
scaffold0223 (33-116)||(16906-16989)
[»] scaffold0170 (1 HSPs)
scaffold0170 (19-98)||(9858-9937)
[»] scaffold0002 (2 HSPs)
scaffold0002 (30-117)||(319446-319533)
scaffold0002 (19-117)||(583-681)
[»] scaffold0041 (1 HSPs)
scaffold0041 (30-116)||(25109-25195)
[»] scaffold0086 (1 HSPs)
scaffold0086 (19-116)||(26196-26293)
[»] scaffold0009 (1 HSPs)
scaffold0009 (19-116)||(42831-42928)
[»] scaffold0316 (1 HSPs)
scaffold0316 (19-117)||(1612-1710)
[»] scaffold0013 (1 HSPs)
scaffold0013 (19-59)||(51744-51784)
[»] scaffold0006 (1 HSPs)
scaffold0006 (19-113)||(68530-68621)
[»] scaffold0005 (3 HSPs)
scaffold0005 (41-117)||(219404-219480)
scaffold0005 (41-116)||(250024-250099)
scaffold0005 (19-66)||(271123-271170)
[»] scaffold0341 (1 HSPs)
scaffold0341 (19-66)||(18645-18692)
[»] scaffold0011 (1 HSPs)
scaffold0011 (58-116)||(224369-224427)
[»] scaffold0384 (1 HSPs)
scaffold0384 (34-107)||(6000-6073)
[»] scaffold0079 (1 HSPs)
scaffold0079 (19-63)||(8188-8231)


Alignment Details
Target: chr4 (Bit Score: 143; Significance: 3e-75; HSPs: 62)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 19 - 243
Target Start/End: Original strand, 52950097 - 52950322
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagcn 118  Q
    |||||||||| |||||||||||||||||||| |||||| |||||| |||||||| ||||| |||| |||||||| ||||| |||||||| |||||||||     
52950097 cgattcccagggggaacaacgcttggccagtgcgcatgactctacacatgaaccagattagtcgtccacctttggtgggtcggaaaccgatgcgaaagca 52950196  T
119 nnnnnnnn-tgtcatggtcttaagcccaaactaaagcatcacagataaatggtgcatataattacatgtgtcacttagctcatgaaaataaaaattatat 217  Q
             |||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52950197 aaaaaaaaatgtcctagtcttaagcccaaactaaagcatcacagataaatggtgcatataattacatgtgtcacttagctcatgaaaataaaaattatat 52950296  T
218 atatgcaccacatagtacttaagaat 243  Q
    ||||||||||||||||||||||||||    
52950297 atatgcaccacatagtacttaagaat 52950322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 53599075 - 53599173
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||||||  ||||||||| ||||||||| |||||| |||||||||||| |||||||||||||||||||||  ||| | ||||||||||||||||||    
53599075 cgattcccaggaggaacaacgtttggccagtgcgcatgcctctacgcatgagccggattaatcgttcacctttagtggatcggaaaccggtgcgaaagc 53599173  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 55921049 - 55921147
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||| ||||||||| ||||| |||| |||||| ||||||| |||| |||||||||||| ||||||||| ||||| ||||||||||||||||||    
55921049 cgattcccagggggaacaacacttggtcagtgcgcatgcctctacgtatgagccggattaatcgctcacctttggtgggtcggaaaccggtgcgaaagc 55921147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 19 - 116
Target Start/End: Complemental strand, 7246742 - 7246645
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    ||||||| || |||||||||||||||||||| |||||| |||||||||||| |||||||| |||  |||||||| ||||| |||||||||||||||||    
7246742 cgattcctagtgggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag 7246645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 20 - 117
Target Start/End: Original strand, 38166043 - 38166140
Alignment:
20 gattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||||| |||||||||||||||||||| |||||| ||||||||| || |||||||| |||  |||||||| ||||| ||||||||||||||||||    
38166043 gattcccagggggaacaacgcttggccagtgcgcatggctctacgcacgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc 38166140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 21 - 116
Target Start/End: Complemental strand, 42722671 - 42722576
Alignment:
21 attcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    ||||||||  ||||||||||||||||||| |||||| |||||||||||| |||||||| ||||||||||||  ||||| | |||||||||||||||    
42722671 attcccaggaggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgttcacctttagtgggtcgaaaaccggtgcgaaag 42722576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 16450315 - 16450413
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||| |||||||||||||||||||| | |||| |||||||||||| || ||||| |||| |||||||| | ||| ||||||||||||||||||    
16450315 cgattcccagggggaacaacgcttggccagtgcacatgcctctacgcatgagccagattagtcgtccacctttggtaggtcggaaaccggtgcgaaagc 16450413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 31 - 117
Target Start/End: Original strand, 38168284 - 38168369
Alignment:
31 ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||||||||||||||| | |||| |||||||||||| |||||||| ||||||||||||  ||||||||||||||||||||||||    
38168284 ggaacaacgcttggccagtgc-catgcctctacgcatgagccggattagtcgttcacctttagtgggttggaaaccggtgcgaaagc 38168369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 19 - 116
Target Start/End: Original strand, 29895802 - 29895899
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    |||||||||| ||||||||| |||||||||| |||||| |||||||||||| |||||||| |||| |||| ||| ||| | |||||||||||||||||    
29895802 cgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgtccaccattggtggttcggaaaccggtgcgaaag 29895899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 30 - 115
Target Start/End: Complemental strand, 40780946 - 40780861
Alignment:
30 gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaa 115  Q
    ||||||||||||||| |||| |||||| |||||||||||| |||||||| |||| |||||||| ||||| ||||||||||||||||    
40780946 gggaacaacgcttggtcagtgcgcatgcctctacgcatgagccggattagtcgtccacctttggtgggtcggaaaccggtgcgaaa 40780861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 30 - 117
Target Start/End: Original strand, 17080069 - 17080156
Alignment:
30 gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||||||||||||| |||||| |||||||||||| |||||||| |||  |||||||||||| | | ||||||||||||||||    
17080069 gggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgcacacctttgatggatcgaaaaccggtgcgaaagc 17080156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 31 - 117
Target Start/End: Original strand, 4738645 - 4738731
Alignment:
31 ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||||| |||||| ||||||||||||||||||| | | |||| |||| |||||||| ||||| ||||||||||||||||||    
4738645 ggaacaacgctttgccagtgcgcatgtctctacgcatgagctgaattagtcgtccacctttggtgggtcggaaaccggtgcgaaagc 4738731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 38075448 - 38075546
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||| ||| || ||||||||||||||||| |||||| |||||||||||| ||| |||||| || |||||||| ||||| |||||||| |||||||||    
38075448 cgattctcaggggaaacaacgcttggccagtgcgcatgcctctacgcatgagccgaattaattgtccacctttggtgggtcggaaaccgatgcgaaagc 38075546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 47078473 - 47078571
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||| |||||||||||||||||||| | |||| ||||||||| || |||||||| ||| ||||| ||| ||||| ||||||| ||||||||||    
47078473 cgattcccagggggaacaacgcttggccagtgcacatgcctctacgcacgagccggattagtcgctcaccattggtgggtcggaaaccagtgcgaaagc 47078571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 31 - 116
Target Start/End: Original strand, 2559334 - 2559419
Alignment:
31 ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    ||||||||||||||||||| |||||| |||||||||  | |||||||| |||| |||||||| ||||| |||||||||||||||||    
2559334 ggaacaacgcttggccagtgcgcatgcctctacgcacaagccggattactcgtccacctttggtgggtcggaaaccggtgcgaaag 2559419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 19 - 116
Target Start/End: Original strand, 14124031 - 14124128
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    |||||||||| |||||||||  ||||||||| |||||| |||||| || || |||||||| ||| ||||| ||| |||||||||||||||||||||||    
14124031 cgattcccagggggaacaacatttggccagtgcgcatgcctctacacacgagccggattagtcgctcaccattggtgggttggaaaccggtgcgaaag 14124128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 19 - 115
Target Start/End: Original strand, 13073553 - 13073649
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaa 115  Q
    |||||||||  |||||||| | ||||||||| |||||  ||||||||||||||| ||||| ||||| ||||||| ||||| ||||||||||||||||    
13073553 cgattcccatggggaacaatgtttggccagtgcgcatacctctacgcatgaaccagattagtcgtttacctttggtgggtcggaaaccggtgcgaaa 13073649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 19 - 114
Target Start/End: Complemental strand, 295628 - 295534
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaa 114  Q
    ||||||||||||| ||||||| ||||||||| |||||| ||||||||| ||||| ||||| |||| |||| ||| |||||| ||||||||||||||    
295628 cgattcccagagg-aacaacgtttggccagtgcgcatgcctctacgcacgaaccagattagtcgtccaccgttggtgggtttgaaaccggtgcgaa 295534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 19 - 110
Target Start/End: Original strand, 8889037 - 8889128
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtg 110  Q
    ||||||| || ||||||||| ||||| |||| |||||| |||||||||||| |||||||| |||| |||||||| ||||| |||||||||||    
8889037 cgattcctagggggaacaacacttgggcagtgcgcatggctctacgcatgagccggattagtcgtccacctttggtgggtcggaaaccggtg 8889128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 20 - 116
Target Start/End: Original strand, 31588700 - 31588798
Alignment:
20 gattcccagagggaacaacgct--tggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    |||||||||||| |||||||||  |||||||| ||||||||||||||||||| |||||||| ||| |||| |||| ||| | |||||||| ||||||||    
31588700 gattcccagaggaaacaacgctcttggccagtgcgcatgtctctacgcatgagccggattagtcgctcacttttggtggatcggaaaccgatgcgaaag 31588798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 20421788 - 20421886
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||| |||| ||||||||| |||||||||| |||||| |||||||||||| || |||||||||| || | ||||||||| ||||||| || |||||||    
20421788 cgatttccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccagattaatcgtccatcattgatgggtcggaaaccagttcgaaagc 20421886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 36145311 - 36145213
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||| || |||||||||||  |||| |||||| |||||| ||||| |||||||| |||| |||||||||||  | ||||||||||||||||||    
36145311 cgattcccaggggaaacaacgcttgatcagtgcgcatgcctctacacatgagccggattagtcgtccacctttgatgaatcggaaaccggtgcgaaagc 36145213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 19 - 116
Target Start/End: Original strand, 30317248 - 30317345
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    |||||| ||||||||||||||||||||||||||| ||| ||||||||| || ||| |||| |||  |||||||| ||||| |||||||| || |||||    
30317248 cgattctcagagggaacaacgcttggccagtacgaatgcctctacgcacgagccgaattagtcgcccacctttggtgggtcggaaaccgatgtgaaag 30317345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 19 - 116
Target Start/End: Original strand, 43458628 - 43458725
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    ||||||||||  |||| |||||||||||||| |||||| ||||||| | || |||||||| |||| ||||||||||| || |||||||| ||||||||    
43458628 cgattcccaggaggaagaacgcttggccagtgcgcatgcctctacggacgagccggattagtcgtccacctttgatgagtcggaaaccgttgcgaaag 43458725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 19 - 116
Target Start/End: Original strand, 43468362 - 43468459
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    |||||||||| |||||||||||||||||||| | ||| ||||||||||||| |||||||| |||  ||||  || ||||| ||| |||||||||||||    
43468362 cgattcccagggggaacaacgcttggccagtgcacatttctctacgcatgagccggattagtcgcccaccagtggtgggtcggagaccggtgcgaaag 43468459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 25 - 117
Target Start/End: Complemental strand, 3159559 - 3159467
Alignment:
25 ccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||| |||||||||||||||||||| |||||| ||||||||| || || ||||| ||| ||||| ||| ||||| |||||||||||| |||||    
3159559 ccagggggaacaacgcttggccagtgcgcatgcctctacgcacgagccagattagtcgctcaccattggtgggtcggaaaccggtgcaaaagc 3159467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 21 - 117
Target Start/End: Complemental strand, 49260759 - 49260663
Alignment:
21 attcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||  |||||||||||||||||||| |||||| ||||||||| || |||||||| |||  |||||||| ||||| ||||| |||||| |||||    
49260759 attcccaaggggaacaacgcttggccagtgcgcatgcctctacgcacgagccggattagtcgaccacctttggtgggtcggaaatcggtgcaaaagc 49260663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 33 - 116
Target Start/End: Complemental strand, 49952228 - 49952144
Alignment:
33 aacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgt-tcacctttgatgggttggaaaccggtgcgaaag 116  Q
    ||||||| |||| |||| |||| | |||||||||||| |||||||| |||  |||||||||||||||||||||||||||||||||    
49952228 aacaacgtttggtcagtgcgcacgcctctacgcatgagccggattagtcgcgtcacctttgatgggttggaaaccggtgcgaaag 49952144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 58 - 117
Target Start/End: Complemental strand, 25406620 - 25406561
Alignment:
58 ctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||||||||| | ||||| ||||||||||||||||||| ||||||||||||||||||    
25406620 ctctacgcatgaatcagattagtcgttcacctttgatgggtcggaaaccggtgcgaaagc 25406561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 10541031 - 10541128
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||| |||| || |||||||||||||||||  ||||| ||||||||| || || |||||||||  |||||||||||| | ||||||||||||||||||    
10541031 cgatttccaggggaaacaacgcttggccagtgtgcatgcctctacgcacgagccagattaatcg-ccacctttgatggatcggaaaccggtgcgaaagc 10541128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 48015169 - 48015071
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||| |||||||||||||||||||| |||| | ||||||||| || |||||||| | |  ||  |||||||| | ||||||||||||||||||    
48015169 cgattcccagtgggaacaacgcttggccagtgcgcaagcctctacgcacgagccggattagtagcccaattttgatggatcggaaaccggtgcgaaagc 48015071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 19 - 88
Target Start/End: Original strand, 1446841 - 1446910
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacc 88  Q
    |||||||||| ||||||||| |||||||||| |||||| |||||||||||| |||||||| |||| ||||    
1446841 cgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgtccacc 1446910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 20 - 117
Target Start/End: Complemental strand, 5472943 - 5472846
Alignment:
20 gattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||| ||| || ||||||||||||||||| |||||| ||||||||| || |||||||| |||  |||||||| ||||| | |||| |||||||||||    
5472943 gattctcaggggaaacaacgcttggccagtgcgcatgcctctacgcacgagccggattagtcgcccacctttggtgggtcgaaaactggtgcgaaagc 5472846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 30 - 117
Target Start/End: Complemental strand, 47682467 - 47682380
Alignment:
30 gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||| |||| ||||||||| | |||||||||||||| || |||| ||| |||  |||||||| ||||| ||||||||||||||||||    
47682467 gggaataacgtttggccagtgcacatgtctctacgcacgagccgggttagtcgcccacctttggtgggtcggaaaccggtgcgaaagc 47682380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 24166465 - 24166563
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||  || ||||||| ||||||||| |||||| ||||||||| || || ||||| ||   |||||||||||| | ||||||||||||||||||    
24166465 cgattcccaagggaaacaacgtttggccagtgcgcatgcctctacgcacgagccagattagtcacccacctttgatggatcggaaaccggtgcgaaagc 24166563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 24 - 117
Target Start/End: Original strand, 18531539 - 18531632
Alignment:
24 cccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||| ||||||||| ||||| |||| |||||| ||| | ||| ||||| ||||| |||| |||||||  ||||| ||||||||||||||||||    
18531539 cccagggggaacaacacttggtcagtgcgcatgcctccatgcacgaaccagattattcgtccaccttttgtgggtcggaaaccggtgcgaaagc 18531632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 19 - 113
Target Start/End: Complemental strand, 1940870 - 1940779
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcga 113  Q
    |||||||||| |||||||||||||||   || |||||| ||||||||| || |||||||| |||  |||||||| ||||| | ||||||||||||    
1940870 cgattcccagggggaacaacgcttgg---gtgcgcatgcctctacgcacgagccggattagtcgcccacctttggtgggtcgaaaaccggtgcga 1940779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 41 - 117
Target Start/End: Complemental strand, 14597974 - 14597898
Alignment:
41 ttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||||| |||||| ||||||||| |||| |||||| |||| |||||||||||| | | |||||||||| |||||    
14597974 ttggccagtgcgcatgcctctacgcacgaactggattagtcgtccacctttgatggatcgaaaaccggtgcaaaagc 14597898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #39
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 36 - 116
Target Start/End: Complemental strand, 15840014 - 15839934
Alignment:
36 aacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    |||| ||||||||| |||||| |||||||||||| |||||||| |||  |  ||||||| ||||||||||| |||||||||    
15840014 aacgtttggccagtgcgcatgcctctacgcatgagccggattagtcgcccttctttgataggttggaaaccagtgcgaaag 15839934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #40
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 19 - 115
Target Start/End: Original strand, 33647736 - 33647832
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaa 115  Q
    ||||| |||| | |||||||||||| ||||| | |||  ||||||||| ||||| ||||| ||||||| ||||| ||| | ||||||||||||||||    
33647736 cgatttccagggagaacaacgcttgaccagtgcacattcctctacgcacgaaccagattagtcgttcatctttggtggatcggaaaccggtgcgaaa 33647832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #41
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 30 - 106
Target Start/End: Complemental strand, 40272416 - 40272340
Alignment:
30 gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaacc 106  Q
    |||||||||||||||||||| |||||| |||||||||| |  ||||||  ||||||||| ||| ||||| |||||||    
40272416 gggaacaacgcttggccagtgcgcatgcctctacgcataagtcggatttgtcgttcaccattggtgggtcggaaacc 40272340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #42
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 33 - 116
Target Start/End: Complemental strand, 2686537 - 2686454
Alignment:
33 aacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    |||||| |||| ||| |||  |||||||||| ||||| ||| |||| |||| |||||||  |||||||||||||||||||||||    
2686537 aacaacacttgaccactacatatgtctctacacatgagccgaattagtcgtccaccttttgtgggttggaaaccggtgcgaaag 2686454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #43
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 41 - 116
Target Start/End: Original strand, 14567276 - 14567351
Alignment:
41 ttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    ||||||||| |||||| ||||||||| || |||||||| ||| || |||||| ||||| ||||| |||||||||||    
14567276 ttggccagtgcgcatgcctctacgcacgagccggattagtcgctcgcctttggtgggtcggaaatcggtgcgaaag 14567351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #44
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 22 - 117
Target Start/End: Original strand, 14858729 - 14858823
Alignment:
22 ttcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||| |||| ||| ||||| ||||| |||||||||||||| | ||  | ||||| |||| ||||||||||||||  |||||||||||||||||    
14858729 ttcccagggggatcaa-gcttgaccagtgcgcatgtctctacgtacgagtcagattattcgtccacctttgatgggtcagaaaccggtgcgaaagc 14858823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #45
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 37 - 115
Target Start/End: Complemental strand, 6032721 - 6032643
Alignment:
37 acgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaa 115  Q
    ||||||| ||||| | |||| ||||||| |||| |||||||| ||||  ||||||| ||||| ||||||||||||||||    
6032721 acgcttgaccagtgctcatgcctctacgaatgagccggattagtcgtctacctttggtgggtcggaaaccggtgcgaaa 6032643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #46
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 20128324 - 20128422
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||| ||| |||||||| ||||||||||| |||||| || |||||| || |  ||||| |||| |||| ||| |||||  |||||||||||||||||    
20128324 cgattctcagggggaacaatgcttggccagtgcgcatgcctttacgcacgagctagattagtcgtccaccattggtgggtcagaaaccggtgcgaaagc 20128422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #47
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 32 - 106
Target Start/End: Original strand, 20354665 - 20354739
Alignment:
32 gaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaacc 106  Q
    |||||||||||||| ||| |||||| ||||||||||||  ||||||| |||| |||  |||||| ||||||||||    
20354665 gaacaacgcttggctagtgcgcatgcctctacgcatgagtcggattagtcgtccactattgatgagttggaaacc 20354739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #48
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 19 - 116
Target Start/End: Complemental strand, 8064894 - 8064797
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    |||||||||  ||||| ||| |||| ||||| |||||| |||||||||||| |||||||| |||| |||| || || ||| | |||||||||| ||||    
8064894 cgattcccaaggggaataacacttgaccagtgcgcatgcctctacgcatgagccggattagtcgtccaccattaataggtcgaaaaccggtgcaaaag 8064797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #49
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 32 - 117
Target Start/End: Original strand, 16645146 - 16645231
Alignment:
32 gaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||||||||||||||  ||||| |||||| |||||  | ||||| |||  ||||| || ||||| ||||||||||||||||||    
16645146 gaacaacgcttggccagtgtgcatgcctctacacatgagtctgattagtcgcccacctgtggtgggtcggaaaccggtgcgaaagc 16645231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #50
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 31 - 76
Target Start/End: Complemental strand, 20532493 - 20532448
Alignment:
31 ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggat 76  Q
    ||||||||||||||||||| |||||| |||||||||||| ||||||    
20532493 ggaacaacgcttggccagtgcgcatgcctctacgcatgagccggat 20532448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #51
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 26480034 - 26479981
Alignment:
30 gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgt 83  Q
    ||||| ||| ||||||||||||||||| |||||||||||| ||| |||||||||    
26480034 gggaataacacttggccagtacgcatgcctctacgcatgagccgaattaatcgt 26479981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #52
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 30 - 107
Target Start/End: Original strand, 46108717 - 46108794
Alignment:
30 gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccg 107  Q
    |||||||||  ||||| ||| |||||| |||||||||||| || ||||| |||| ||| |||||||||| ||||||||    
46108717 gggaacaacatttggctagtgcgcatgcctctacgcatgagccagattagtcgtccacttttgatgggtcggaaaccg 46108794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #53
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 31 - 115
Target Start/End: Original strand, 14859318 - 14859402
Alignment:
31 ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaa 115  Q
    ||||||| | ||| ||||| |||||||||||||||| || || ||||| || | ||||||||||| || |||||| |||||||||    
14859318 ggaacaatgtttgaccagtgcgcatgtctctacgcacgagccagattagtcatccacctttgatgtgtcggaaactggtgcgaaa 14859402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #54
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 30 - 114
Target Start/End: Original strand, 21429327 - 21429411
Alignment:
30 gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaa 114  Q
    |||||||||| || |||||| |||||| ||||||||| ||  | || || |||| |||||||| ||||| |||||||||||||||    
21429327 gggaacaacgtttagccagtgcgcatgcctctacgcacgagtcagactagtcgtccacctttggtgggtcggaaaccggtgcgaa 21429411  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #55
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 29 - 117
Target Start/End: Complemental strand, 36262853 - 36262765
Alignment:
29 agggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||||||||||||||||| | |||| ||||||||| ||  ||||||| |||  |||||||| |||||  ||||||  |||||||||    
36262853 agggaacaacgcttggccagtgcacatgcctctacgcacgagtcggattagtcgcccacctttggtgggtcagaaaccaatgcgaaagc 36262765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #56
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 72 - 116
Target Start/End: Original strand, 45721154 - 45721198
Alignment:
72 cggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    ||||||| |||| ||||||| ||||||||||||||||||||||||    
45721154 cggattagtcgtccacctttaatgggttggaaaccggtgcgaaag 45721198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #57
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 31 - 111
Target Start/End: Complemental strand, 48317359 - 48317279
Alignment:
31 ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgc 111  Q
    |||||||||||||| ||||  | ||| ||||||||| || |||||||| |||  |||| ||||||||||||||||| ||||    
48317359 ggaacaacgcttggtcagtgtgtatgcctctacgcacgagccggattagtcgcccaccgttgatgggttggaaaccagtgc 48317279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #58
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 32 - 104
Target Start/End: Original strand, 53354560 - 53354632
Alignment:
32 gaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaa 104  Q
    ||||||| |||  ||||| |||||| |||||||||| || ||||||| ||||||| ||||||||||| |||||    
53354560 gaacaacacttaaccagtgcgcatgcctctacgcataaatcggattagtcgttcatctttgatgggtcggaaa 53354632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #59
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 105
Target Start/End: Original strand, 3507286 - 3507371
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaac 105  Q
    ||||||||| ||||||||||||||||| ||| ||| || |||||| || || |||||||| |||| |||||||| ||| | ||||||    
3507286 cgattccca-agggaacaacgcttggctagtgcgcgtgcctctacacacgagccggattagtcgtccacctttggtggatcggaaac 3507371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #60
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 31 - 117
Target Start/End: Original strand, 21192667 - 21192753
Alignment:
31 ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||||| | ||||||| |||||| ||||||||| ||  |||||||||||  ||| |||| || || | ||||||||||||||||    
21192667 ggaacaacgttgggccagtgcgcatgcctctacgcacgagtcggattaatcgcccacatttggtgagtcgaaaaccggtgcgaaagc 21192753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #61
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 40 - 78
Target Start/End: Original strand, 33109360 - 33109398
Alignment:
40 cttggccagtacgcatgtctctacgcatgaaccggatta 78  Q
    ||||||||||||||||||||||||||| || ||||||||    
33109360 cttggccagtacgcatgtctctacgcacgagccggatta 33109398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #62
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 29 - 109
Target Start/End: Original strand, 52209637 - 52209717
Alignment:
29 agggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggt 109  Q
    ||||||||||||||||  ||| |||| |  |||||||||||  | ||||||||||||| | |||||||||  |||||||||    
52209637 agggaacaacgcttggatagtgcgcacgcttctacgcatgagtcagattaatcgttcatcattgatgggtcagaaaccggt 52209717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0291 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: scaffold0291
Description:

Target: scaffold0291; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 6868 - 6966
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||| ||||||||| |||||||||| |||||| |||||||||||| |||||||| ||| ||||||||| ||||| ||||||||||||||||||    
6868 cgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgctcacctttggtgggtcggaaaccggtgcgaaagc 6966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 63; Significance: 2e-27; HSPs: 41)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 5253319 - 5253221
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||| ||||||||| |||||||||| |||||| |||||||||||| ||||||||||||  |||||||| ||||| ||||||||||||||||||    
5253319 cgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattaatcgcccacctttggtgggtcggaaaccggtgcgaaagc 5253221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 21898662 - 21898760
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||||||  ||||||||||||||||||| |||||| |||||||||||| |||||||| ||||||||||||  ||||| ||||||||||||||||||    
21898662 cgattcccaggaggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgttcacctttagtgggtcggaaaccggtgcgaaagc 21898760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 8932675 - 8932773
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||| ||||||||| |||||| ||| |||||| |||||||||||| |||||||||||   |||||||||||||| ||||||||||||||||||    
8932675 cgattcccagggggaacaacacttggctagtgcgcatgcctctacgcatgagccggattaatcacccacctttgatgggtcggaaaccggtgcgaaagc 8932773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 8944141 - 8944239
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||| ||||||||| |||||| ||| |||||| |||||||||||| |||||||||||   |||||||||||||| ||||||||||||||||||    
8944141 cgattcccagggggaacaacacttggctagtgcgcatgcctctacgcatgagccggattaatcacccacctttgatgggtcggaaaccggtgcgaaagc 8944239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 3601098 - 3601196
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||| ||| |||||||||||||||||||| |||||| || ||| || || |||||||| |||| |||||||| ||||| ||||||||||||||||||    
3601098 cgattctcagggggaacaacgcttggccagtgcgcatgcctatacacacgagccggattagtcgtccacctttggtgggtcggaaaccggtgcgaaagc 3601196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 32 - 117
Target Start/End: Complemental strand, 9633708 - 9633623
Alignment:
32 gaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||||||||||| |||||| ||||||||| || |||||||| |||  |||||||| ||||| ||||||||||||||||||    
9633708 gaacaacgcttggccagtgcgcatgcctctacgcacgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc 9633623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 20 - 117
Target Start/End: Original strand, 19089513 - 19089610
Alignment:
20 gattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||||| ||||||||| ||||||||||  ||||| ||||||||| || |||||||| ||||  ||||||| ||||| ||||||||||||||||||    
19089513 gattcccagggggaacaacacttggccagtgagcatgcctctacgcacgagccggattagtcgtctacctttggtgggtcggaaaccggtgcgaaagc 19089610  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 3588041 - 3587943
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||  |||||||||||||||||||| | |||  ||||||||||||||||||||| ||||  ||||||||||| | |||||| | |||||||||    
3588041 cgattcccaaggggaacaacgcttggccagtgcacatacctctacgcatgaaccggattagtcgtcaacctttgatggatcggaaactgatgcgaaagc 3587943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 6606193 - 6606095
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||| ||| ||||||||| ||||||||||   |||| |||||||||||| |||||||| |||| |||| ||| ||||| ||||||||||||||||||    
6606193 cgattctcagggggaacaacacttggccagtgtacatgcctctacgcatgagccggattagtcgtccaccattggtgggtcggaaaccggtgcgaaagc 6606095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 12606444 - 12606542
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||| |||| |||||||||| ||||||||| |||||| ||||||||| || |||||||| |||  |||||||| || | |||||||||||||||||||    
12606444 cgatttccagggggaacaacgtttggccagtgcgcatgcctctacgcacgagccggattagtcgcccacctttggtgagctggaaaccggtgcgaaagc 12606542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 19 - 116
Target Start/End: Original strand, 8938725 - 8938822
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    ||||||||||  |||||||| |||| ||||| |||| |  ||||||||||| ||| |||| |||| |||||||||||||| |||||||||||||||||    
8938725 cgattcccaggaggaacaacacttgaccagtgcgcaagcatctacgcatgagccgaattagtcgtccacctttgatgggtcggaaaccggtgcgaaag 8938822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 32 - 111
Target Start/End: Complemental strand, 2271386 - 2271307
Alignment:
32 gaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgc 111  Q
    ||||||||||| |||||| |||||||||||||||| || |||||||| |||| ||||||||||||||  |||||| ||||    
2271386 gaacaacgcttagccagtgcgcatgtctctacgcacgagccggattagtcgtccacctttgatgggtcagaaaccagtgc 2271307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 30 - 117
Target Start/End: Complemental strand, 13036089 - 13036002
Alignment:
30 gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||||| |||||||||| |||||| |||||||||||| || ||||| |||| |||  ||| ||||| ||||||||||||||||||    
13036089 gggaacaacacttggccagtgcgcatgcctctacgcatgagccagattagtcgtccactattggtgggtcggaaaccggtgcgaaagc 13036002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 30 - 117
Target Start/End: Complemental strand, 29444850 - 29444763
Alignment:
30 gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||||||||||||| |||||| |||||||||||| |||||||| | || || ||||| ||||| ||||||  ||||||||||    
29444850 gggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagttgtccatctttggtgggtcggaaactagtgcgaaagc 29444763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 31 - 117
Target Start/End: Complemental strand, 8612058 - 8611972
Alignment:
31 ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||||||||| |||||  |||||  |||||||||||||||||||| |||  |||||||| |||||  |||||||||||||||||    
8612058 ggaacaacgcttgaccagtgtgcatgcttctacgcatgaaccggattagtcgcccacctttggtgggtcagaaaccggtgcgaaagc 8611972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 31 - 117
Target Start/End: Complemental strand, 30788937 - 30788851
Alignment:
31 ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||||| ||||||||| |||||| ||||| ||| || |||||||| |||  |||||||| ||||| ||||||||||||||||||    
30788937 ggaacaacgtttggccagtgcgcatgcctctaggcacgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc 30788851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 34954715 - 34954617
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||| ||| |||||||||| ||||||||| | |||  |||||||||||| || ||||| |||| |||||||||||||| |||||||  |||||||||    
34954715 cgattctcagggggaacaacgtttggccagtgcacatacctctacgcatgagccagattagtcgtccacctttgatgggtcggaaaccaatgcgaaagc 34954617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 61 - 117
Target Start/End: Original strand, 21167431 - 21167487
Alignment:
61 tacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||||| ||||||||||||| |||| ||||||||||| ||||||||||||||||    
21167431 tacgcatgagccggattaatcgtccaccattgatgggttgaaaaccggtgcgaaagc 21167487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 21 - 117
Target Start/End: Original strand, 31129193 - 31129289
Alignment:
21 attcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||| ||| |||| ||||||||||| ||| |||||| |||||||||||| || ||||| | || |||||||| || || ||||||||||||||||||    
31129193 attcacagggggagcaacgcttggctagtgcgcatgcctctacgcatgagccagattagttgtgcacctttggtgagtcggaaaccggtgcgaaagc 31129289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 29333224 - 29333138
Alignment:
30 gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    |||||||||| ||||||||| |||||| |||||||||||| ||| || | |||| |||||||| | ||| || ||||||||||||||    
29333224 gggaacaacgtttggccagtgcgcatgcctctacgcatgagccgaatcagtcgtccacctttggtaggtcggtaaccggtgcgaaag 29333138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 31 - 117
Target Start/End: Original strand, 30410471 - 30410557
Alignment:
31 ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||| |||  ||||| |||||| |||||||||||| | |||||||||| ||| ||||| ||||| |||||||| |||||||||    
30410471 ggaacaacacttaaccagtgcgcatgcctctacgcatgagctggattaatcgctcatctttggtgggtcggaaaccgatgcgaaagc 30410557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 116
Target Start/End: Complemental strand, 9179832 - 9179735
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    |||||||||| ||||||||| |||| |||||| ||||  |||||||||||| | |||||| |||| |||||||| ||| | ||||| |||| ||||||    
9179832 cgattcccagggggaacaacacttgaccagtatgcatacctctacgcatgagctggattagtcgtccacctttggtggatcggaaatcggtccgaaag 9179735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 20 - 117
Target Start/End: Original strand, 12635829 - 12635926
Alignment:
20 gattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||||| || ||||||||||||| ||| |||||| |||||||||  | |||||||| |||  |||  ||| ||||| ||||||||||||||||||    
12635829 gattcccaggggaaacaacgcttggctagtgcgcatgcctctacgcacaagccggattagtcgcccactattggtgggtcggaaaccggtgcgaaagc 12635926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 52 - 117
Target Start/End: Complemental strand, 14783483 - 14783418
Alignment:
52 gcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||| |||||||||||| |||||||| |||| |||| ||| ||||| ||||||||||||||||||    
14783483 gcatgcctctacgcatgagccggattagtcgtccaccattggtgggtcggaaaccggtgcgaaagc 14783418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 21 - 117
Target Start/End: Original strand, 13468949 - 13469045
Alignment:
21 attcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||| || |||||||||| |||| |||| | |||| ||||||||| || || ||||| |||  |||| ||| ||||||||||||||||||||||||    
13468949 attcctagggggaacaacgattggtcagtgcacatgcctctacgcacgagccagattagtcgcccaccattggtgggttggaaaccggtgcgaaagc 13469045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 32 - 117
Target Start/End: Complemental strand, 13584533 - 13584444
Alignment:
32 gaacaacgcttggccagtacgcatgtctctacgcatgaa----ccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||| ||||||||| |||||| ||||| ||||| |    ||||||||||||| |||||||| ||||| ||||||||| ||||||||    
13584533 gaacaacgtttggccagtgcgcatgcctctatgcatgcatgagccggattaatcgtccacctttggtgggtcggaaaccggcgcgaaagc 13584444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 17114993 - 17114901
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgc 111  Q
    ||||||| ||| ||||||||||||||||| |   |||| |||||||||||| |||||||| |||  |||||||||| ||| ||||| ||||||    
17114993 cgattcctagaaggaacaacgcttggccaatggacatgcctctacgcatgagccggattagtcgcccacctttgataggtcggaaatcggtgc 17114901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 30 - 117
Target Start/End: Complemental strand, 10311554 - 10311467
Alignment:
30 gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||||||||||||| |||||||||||||||| ||    ||||| ||| ||||| ||| ||||| | |||| |||||||||||    
10311554 gggaacaacgcttggccagtgcgcatgtctctacgcacgagttagattagtcgctcaccattggtgggtcgaaaactggtgcgaaagc 10311467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 29 - 100
Target Start/End: Complemental strand, 19230645 - 19230574
Alignment:
29 agggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttg 100  Q
    |||||||||||||||| ||||| ||||| ||||||||| || |||||||| ||||||| | ||| |||||||    
19230645 agggaacaacgcttggtcagtatgcatgcctctacgcacgagccggattagtcgttcatcattggtgggttg 19230574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #30
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 5029831 - 5029929
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||| ||| | |||||||| |||| |||| |||||| ||||||||||||   |||||| |||  || ||||||||||| |||||| |||||||||||    
5029831 cgattctcagggagaacaacgtttggtcagtgcgcatgcctctacgcatgagttggattagtcgcccatctttgatgggtcggaaactggtgcgaaagc 5029929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #31
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 53 - 115
Target Start/End: Complemental strand, 8149859 - 8149797
Alignment:
53 catgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaa 115  Q
    |||| |||||||||| | ||| |||| |||| |||||||| ||||||||||||||||||||||    
8149859 catgcctctacgcattagccgaattagtcgtccacctttggtgggttggaaaccggtgcgaaa 8149797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #32
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 14107454 - 14107356
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||||||  ||||||||||||| ||||| | |||| |||||||||||| |||||||| |||  ||   ||  ||||| ||||||||||||||||||    
14107454 cgattcccaggaggaacaacgcttgaccagtgcacatgcctctacgcatgagccggattagtcgcccattattagtgggtcggaaaccggtgcgaaagc 14107356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #33
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 33 - 96
Target Start/End: Original strand, 8888910 - 8888973
Alignment:
33 aacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgg 96  Q
    ||||||| ||||||||| |||||  ||||||||||||  ||||||| |||| ||||||||||||    
8888910 aacaacgtttggccagtgcgcatacctctacgcatgagtcggattagtcgtccacctttgatgg 8888973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #34
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 30 - 109
Target Start/End: Original strand, 21945314 - 21945392
Alignment:
30 gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggt 109  Q
    |||||||||||||||||||| || ||| ||||| |||||| ||||| ||||||| ||  ||| || ||||||||||||||    
21945314 gggaacaacgcttggccagttcgtatgcctctatgcatgagccggaataatcgtccattttttat-ggttggaaaccggt 21945392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #35
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 21 - 116
Target Start/End: Complemental strand, 24671960 - 24671865
Alignment:
21 attcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    |||||||||||||||||| |||| |||||  ||||| |||||||||  | |||||||| | || | |||||||||| | ||||| ||||| |||||    
24671960 attcccagagggaacaacacttgaccagtgtgcatgcctctacgcacaagccggattagtagtccgcctttgatggttcggaaatcggtgtgaaag 24671865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #36
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 72 - 117
Target Start/End: Complemental strand, 13116173 - 13116128
Alignment:
72 cggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||||||||  |||| ||||| ||||||||||||||||||    
13116173 cggattaatcgttcatttttggtgggtcggaaaccggtgcgaaagc 13116128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #37
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 31 - 91
Target Start/End: Original strand, 5333030 - 5333090
Alignment:
31 ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcaccttt 91  Q
    |||||||| |||| ||||| ||||||||||||| ||||| || ||||| ||||||| ||||    
5333030 ggaacaacacttgtccagtgcgcatgtctctacacatgagccagattagtcgttcatcttt 5333090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #38
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 30 - 78
Target Start/End: Complemental strand, 9366508 - 9366460
Alignment:
30 gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggatta 78  Q
    ||||| |||||||||||||| |||||| ||||||||| || ||||||||    
9366508 gggaataacgcttggccagtgcgcatgcctctacgcacgagccggatta 9366460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #39
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 115
Target Start/End: Original strand, 11142617 - 11142713
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaa 115  Q
    |||||| ||| || ||||||| ||| ||||| |||||| ||||||||||||  | ||||| | || || ||||| ||||| ||| ||||||||||||    
11142617 cgattcgcagtggaaacaacgtttgaccagtgcgcatgcctctacgcatgagtcagattagttgtccaactttggtgggtcggagaccggtgcgaaa 11142713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #40
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 53 - 117
Target Start/End: Original strand, 14326045 - 14326109
Alignment:
53 catgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||| |||||||||||| |||||||| ||| ||| ||||| ||||| ||||| |||||| |||||    
14326045 catgcctctacgcatgagccggattagtcgctcatctttggtgggtcggaaaacggtgcaaaagc 14326109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #41
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 53 - 117
Target Start/End: Original strand, 14419055 - 14419119
Alignment:
53 catgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||| |||||||||||| |||||||| ||| ||| ||||| ||||| ||||| |||||| |||||    
14419055 catgcctctacgcatgagccggattagtcgctcatctttggtgggtcggaaaacggtgcaaaagc 14419119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 63; Significance: 2e-27; HSPs: 56)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 1538442 - 1538540
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||| ||||||||| |||||||||| |||||| |||||||||||| ||||||||||||| |||| ||| ||||| ||||||||||||||||||    
1538442 cgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattaatcgtccaccattggtgggtcggaaaccggtgcgaaagc 1538540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 9805015 - 9805113
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||| |||||||||||||||||||| |||||| |||||||||||| |||||||| |||| |||||||| ||||| |||||| |||||||||||    
9805015 cgattcccagggggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgtccacctttggtgggtcggaaacaggtgcgaaagc 9805113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 40117426 - 40117524
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||| |||| |||||||||||||||||||| |||||| |||||||||||| |||||||||||||||||||||| ||| | | ||||||||||||||||    
40117426 cgatttccagggggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattaatcgttcacctttggtggatcgaaaaccggtgcgaaagc 40117524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 42086338 - 42086436
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||| |||||||||||||| ||||| |||||| |||||||||||| |||||||| |||| |||||||| ||||| ||||||||||||||||||    
42086338 cgattcccagggggaacaacgcttgaccagtgcgcatgcctctacgcatgagccggattagtcgtccacctttggtgggtcggaaaccggtgcgaaagc 42086436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 20 - 117
Target Start/End: Original strand, 19572736 - 19572833
Alignment:
20 gattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||||| ||||||||| |||||||||| |||||| |||||||||||| |||||||| ||||||||| ||| ||||||||||||| ||||||||||    
19572736 gattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgttcaccattggtgggttggaaaccagtgcgaaagc 19572833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 20 - 117
Target Start/End: Complemental strand, 20682712 - 20682615
Alignment:
20 gattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||| |||| |||||||||||||||||||| |||||| ||||||||| || ||||||||||||  |||||||  ||||||||||||||||||||||||    
20682712 gatttccagggggaacaacgcttggccagtgcgcatgcctctacgcacgagccggattaatcgaccacctttagtgggttggaaaccggtgcgaaagc 20682615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 5732016 - 5731918
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||||||  ||||||||||||||||||| |||||| ||||||| |||| || ||||| ||||||||||||  ||||| ||||||||||||||||||    
5732016 cgattcccaggaggaacaacgcttggccagtgcgcatgcctctacgtatgagccagattagtcgttcacctttagtgggtcggaaaccggtgcgaaagc 5731918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 23383668 - 23383766
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||| |||||||||||||||||||| ||| || |||||||||||| | |||||| |||| |||||||| ||||| |||||| |||||||||||    
23383668 cgattcccagggggaacaacgcttggccagtgcgcttgcctctacgcatgagctggattagtcgtccacctttggtgggtcggaaactggtgcgaaagc 23383766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 30 - 117
Target Start/End: Original strand, 13664282 - 13664369
Alignment:
30 gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||||| |||||||||| |||||| |||||||||||| || ||||||||| ||||||||| || || ||||||||||||||||||    
13664282 gggaacaacacttggccagtgcgcatgcctctacgcatgagccagattaatcgatcacctttggtgtgtcggaaaccggtgcgaaagc 13664369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 34 - 117
Target Start/End: Original strand, 14728109 - 14728192
Alignment:
34 acaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||||||| |||| |||||| |||||||||||| |||||||| | | ||||||||||||||| ||||||||||||||||||    
14728109 acaacgcttggtcagtgcgcatgcctctacgcatgagccggattagttgctcacctttgatgggtcggaaaccggtgcgaaagc 14728192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 20 - 115
Target Start/End: Complemental strand, 42291600 - 42291505
Alignment:
20 gattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaa 115  Q
    ||||||||| | |||||||||||||||||| | |||| ||||||||| || |||||||| |||| |||||||||||| | ||||||||||||||||    
42291600 gattcccagggtgaacaacgcttggccagtgcacatgcctctacgcacgagccggattagtcgtccacctttgatggatcggaaaccggtgcgaaa 42291505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 11845886 - 11845800
Alignment:
30 gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    |||||||||| ||||||||| |||||| ||||||| |||| ||| ||||||||  |||||||||||||||||||||||||| |||||    
11845886 gggaacaacgtttggccagtgcgcatgcctctacgtatgagccgaattaatcgcccacctttgatgggttggaaaccggtgtgaaag 11845800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 33 - 117
Target Start/End: Complemental strand, 42861300 - 42861216
Alignment:
33 aacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||| |||||||||| |||||| |||||||||||| ||||||||||||| |||| ||| ||||| ||| ||||||||||||||    
42861300 aacaacacttggccagtgcgcatgcctctacgcatgagccggattaatcgtccaccattggtgggtcggagaccggtgcgaaagc 42861216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 30 - 117
Target Start/End: Original strand, 41800999 - 41801086
Alignment:
30 gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||||||| ||| | |||||||||||||||| || |||||||| ||||||| ||||||||||| ||||| ||||| ||||||    
41800999 gggaacaacgcttgaccaatgcgcatgtctctacgcacgagccggattagtcgttcatctttgatgggtcggaaagcggtgtgaaagc 41801086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 31 - 117
Target Start/End: Original strand, 7866604 - 7866690
Alignment:
31 ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||||||||||||  ||||| ||||||||| ||||||||||| |||  |||||||| |||||| |||||| ||||||||||    
7866604 ggaacaacgcttggccagtgtgcatgcctctacgcacgaaccggattagtcgcccacctttggtgggttagaaaccagtgcgaaagc 7866690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 31 - 117
Target Start/End: Original strand, 9812895 - 9812981
Alignment:
31 ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||||||||||||  |||||  |||||||||||||||||||| |||  |||||||| |||||  |||||||||||||||||    
9812895 ggaacaacgcttggccagtgtgcatgcttctacgcatgaaccggattagtcgcccacctttggtgggtcagaaaccggtgcgaaagc 9812981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 41163555 - 41163458
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||| |||||||||| ||||||||| | ||||||||||||||||| | |||||| |||| |||||||  ||||| |||||| |||||||||||    
41163555 cgattcccag-gggaacaacgtttggccagtgcacatgtctctacgcatgagctggattagtcgtccaccttttgtgggtcggaaactggtgcgaaagc 41163458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 19 - 96
Target Start/End: Complemental strand, 7308460 - 7308383
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgg 96  Q
    |||||||||| ||||||||||||||| |||| | |||| |||||||||||| |||||||| ||| |||||||||||||    
7308460 cgattcccagggggaacaacgcttgggcagtgcacatgcctctacgcatgagccggattagtcgctcacctttgatgg 7308383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 19 - 116
Target Start/End: Complemental strand, 25417279 - 25417182
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    |||||||||| |||||||||||||||||||| |||||| ||||||| | || |||||||| || || ||| ||| |||||  ||||||||||||||||    
25417279 cgattcccagggggaacaacgcttggccagtgcgcatgcctctacgaacgagccggattagtcatttaccattggtgggtcagaaaccggtgcgaaag 25417182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 19 - 115
Target Start/End: Original strand, 20525849 - 20525945
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaa 115  Q
    ||||||||||  |||||||| ||| |||||| |||||| |||||||||||| |||||||| |||| |||| ||| ||| | ||||||||||||||||    
20525849 cgattcccaggtggaacaacacttcgccagtgcgcatgcctctacgcatgagccggattagtcgtccaccattggtggatcggaaaccggtgcgaaa 20525945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 32 - 104
Target Start/End: Original strand, 24875369 - 24875441
Alignment:
32 gaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaa 104  Q
    |||||||| ||| ||||| |||||||||||||||| || ||||||||||||| |||||||||||||| |||||    
24875369 gaacaacgtttgaccagtgcgcatgtctctacgcacgagccggattaatcgtccacctttgatgggtcggaaa 24875441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 18 - 117
Target Start/End: Complemental strand, 9168349 - 9168251
Alignment:
18 acgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||||||| ||||||||||||||||| |||||  |||||||||||| |||||||| |||| |||||||  ||||| | ||| |||||| |||||    
9168349 acgattcccagagg-aacaacgcttggccagtgcgcatacctctacgcatgagccggattagtcgtccacctttagtgggtcgaaaatcggtgcaaaagc 9168251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 30 - 117
Target Start/End: Complemental strand, 39099864 - 39099777
Alignment:
30 gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||||| |||||||||| | |||| |||||||||||| |||||||| |||  |||||||| ||||| |||||||||||| |||||    
39099864 gggaacaacacttggccagtgcacatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcaaaagc 39099777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 8513530 - 8513628
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||| || || ||||| ||||||||||| | |||| ||||||||| || || ||||| |||| |||||||| ||||| ||||||||||||||||||    
8513530 cgattcctaggggaaacaatgcttggccagtgcacatgcctctacgcacgagccagattagtcgtccacctttggtgggtcggaaaccggtgcgaaagc 8513628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 31 - 117
Target Start/End: Original strand, 12705037 - 12705123
Alignment:
31 ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||||||||| |||||  |||||  |||||||||||||||||||| |||  |||||||| |||||  |||||||||||||||||    
12705037 ggaacaacgcttgaccagtgtgcatgcttctacgcatgaaccggattagtcgcccacctttggtgggtcagaaaccggtgcgaaagc 12705123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 31 - 117
Target Start/End: Original strand, 12766154 - 12766240
Alignment:
31 ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||| |||||||||||  ||||| ||||||||||||||| ||||| |||  |||||||| |||||  |||||||||||||||||    
12766154 ggaacaatgcttggccagtgtgcatgcctctacgcatgaaccagattagtcgcccacctttggtgggtcagaaaccggtgcgaaagc 12766240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 19 - 93
Target Start/End: Original strand, 26077152 - 26077226
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttga 93  Q
    ||||||||||||||||||||||||||||||| | |||| ||||||||| || || ||||||||| ||| ||||||    
26077152 cgattcccagagggaacaacgcttggccagtgcacatgcctctacgcacgagccagattaatcgctcatctttga 26077226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 35 - 117
Target Start/End: Original strand, 27484188 - 27484270
Alignment:
35 caacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||| |||| |||||| ||||| |||||||||||||||||||||  ||| || ||||||| ||||||||||||||| ||||||    
27484188 caacacttgaccagtatgcatgcctctacgcatgaaccggattagacgtccatctttgataggttggaaaccggtgtgaaagc 27484270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 30 - 115
Target Start/End: Original strand, 37263262 - 37263347
Alignment:
30 gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaa 115  Q
    |||||||||||||||||| | |||||| ||||||||| || |||||||| |||| |||||||  ||| | ||||||||||||||||    
37263262 gggaacaacgcttggccaatgcgcatgcctctacgcacgagccggattagtcgtccacctttattggatcggaaaccggtgcgaaa 37263347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 20 - 116
Target Start/End: Original strand, 20692945 - 20693041
Alignment:
20 gattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    |||||| ||||| ||||||||||||||||||| |||| ||||  ||||||  | ||||| | || |||||||| ||||| |||||||||||||||||    
20692945 gattcctagaggaaacaacgcttggccagtacacatgcctctgtgcatgattcagattagttgtccacctttggtgggtcggaaaccggtgcgaaag 20693041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 63 - 115
Target Start/End: Original strand, 40060339 - 40060391
Alignment:
63 cgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaa 115  Q
    ||||||| ||||||||||||| |||| ||||||||||||||||||||||||||    
40060339 cgcatgagccggattaatcgtccaccattgatgggttggaaaccggtgcgaaa 40060391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 58 - 117
Target Start/End: Original strand, 28857196 - 28857255
Alignment:
58 ctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||||| |||||||| ||| ||||||||| ||||| ||||||||||||||||||    
28857196 ctctacgcatgagccggattagtcgctcacctttggtgggtcggaaaccggtgcgaaagc 28857255  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #33
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 30 - 117
Target Start/End: Complemental strand, 38897804 - 38897717
Alignment:
30 gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||||||||||||| |||||| ||||||||| || |||||||| | |  |||||||| ||| | ||||||| ||||||||||    
38897804 gggaacaacgcttggccagtgcgcatgcctctacgcacgagccggattagttgcccacctttggtggatcggaaaccagtgcgaaagc 38897717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #34
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 30 - 117
Target Start/End: Original strand, 43399150 - 43399237
Alignment:
30 gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||| |||||||||||||| |||||| ||||||||| || | |||||| |||| ||| |||| | ||| ||||||||||||||||||    
43399150 gggaataacgcttggccagtgcgcatgcctctacgcacgagcaggattagtcgtccacatttggttggtcggaaaccggtgcgaaagc 43399237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #35
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 2485218 - 2485304
Alignment:
30 gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    ||||||||| || |||| || |||||| ||||||| ||||  ||||||| ||| ||||||||||||||| |||||||| ||||||||    
2485218 gggaacaaccctgggcctgtgcgcatgcctctacgtatgagtcggattagtcgctcacctttgatgggtcggaaaccgatgcgaaag 2485304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #36
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 12081919 - 12082017
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||| ||| |||||||||||||||||||| ||||||  |||||||| || ||| |||| |||| |||||||| || || ||||| ||||| ||||||    
12081919 cgattctcagggggaacaacgcttggccagtgcgcatgcatctacgcacgagccgaattagtcgtccacctttggtgagtcggaaatcggtgtgaaagc 12082017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #37
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 23247447 - 23247350
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||||||  |||||||||||||  ||||| ||||| ||||||||| || || ||||| |||| |||||||||| ||| | ||||||||||||||||    
23247447 cgattcccaggaggaacaacgcttgatcagtatgcatgcctctacgcacgagccagattagtcgtccacctttgat-ggtcgaaaaccggtgcgaaagc 23247350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #38
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 31 - 116
Target Start/End: Complemental strand, 14588701 - 14588616
Alignment:
31 ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    |||| |||||||| ||||| |||||| |||||||||||| |||||||| |||| |||||||| || |  | |||||||||||||||    
14588701 ggaataacgcttgaccagtgcgcatgcctctacgcatgagccggattagtcgtccacctttggtgagccgaaaaccggtgcgaaag 14588616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #39
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 32 - 117
Target Start/End: Original strand, 20255393 - 20255478
Alignment:
32 gaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||| |||| ||||| |||||| ||||||||||||  ||||||| |||| |||||||| || || |||||| |||||||||||    
20255393 gaacaacacttgaccagtgcgcatgcctctacgcatgagtcggattagtcgtccacctttggtgagtcggaaactggtgcgaaagc 20255478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #40
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 30 - 106
Target Start/End: Complemental strand, 18294569 - 18294493
Alignment:
30 gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaacc 106  Q
    ||||||||||||||| |||| |||||  |||||| ||||||||||||||||||  || ||||| ||||| |||||||    
18294569 gggaacaacgcttggtcagtgcgcatacctctacacatgaaccggattaatcgcccatctttggtgggtcggaaacc 18294493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #41
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 61 - 117
Target Start/End: Original strand, 28857002 - 28857058
Alignment:
61 tacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||||| |||||||| ||| ||||||||| ||||| ||||||||||||||||||    
28857002 tacgcatgagccggattagtcgctcacctttggtgggtcggaaaccggtgcgaaagc 28857058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #42
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 19 - 74
Target Start/End: Original strand, 28857139 - 28857194
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccgg 74  Q
    |||||||||| ||||||||| |||||||||| |||||| |||||||||||| ||||    
28857139 cgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccgg 28857194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #43
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 30 - 117
Target Start/End: Original strand, 38369721 - 38369808
Alignment:
30 gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||||| |||||||||| |||||| ||||||||| ||  ||||||| |    ||||||||||||||| |||| ||||||||||||    
38369721 gggaacaacacttggccagtgcgcatgcctctacgcacgagtcggattagtaacccacctttgatgggttagaaatcggtgcgaaagc 38369808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #44
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 14152061 - 14152159
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||| || |||||||||||||||||||||  |||||  ||||  ||||| ||||||||||||| |||| ||||||| | | |||||  |||||||||    
14152061 cgattctcatagggaacaacgcttggccagtgtgcatgcttctatccatgagccggattaatcgtccaccattgatggatcgaaaacctatgcgaaagc 14152159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #45
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 32 - 117
Target Start/End: Complemental strand, 3653997 - 3653912
Alignment:
32 gaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||||| ||||| |||||| ||||||||| ||  ||||||| |||| |||||||| ||| | | |||||||||| |||||    
3653997 gaacaacgcttgaccagtgcgcatgcctctacgcacgaggcggattagtcgtccacctttggtggatcgaaaaccggtgcaaaagc 3653912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #46
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 18136376 - 18136274
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaat----cgttcacctttgatgggttggaaaccggtgcgaa 114  Q
    |||||||||| ||||||||| ||||| ||||  ||||| |||||| ||||| ||||||||||    ||| |||| ||| ||||| |||||||||||| ||    
18136376 cgattcccagggggaacaacacttggtcagtgtgcatgcctctacacatgagccggattaattagtcgtccaccattggtgggtcggaaaccggtgcaaa 18136277  T
115 agc 117  Q
    |||    
18136276 agc 18136274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #47
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 30 - 78
Target Start/End: Original strand, 20590021 - 20590069
Alignment:
30 gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggatta 78  Q
    |||||||||||||||||||| |||||| |||||||||||| ||| ||||    
20590021 gggaacaacgcttggccagtgcgcatgactctacgcatgagccgtatta 20590069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #48
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 29 - 117
Target Start/End: Original strand, 21375372 - 21375460
Alignment:
29 agggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||||||  ||| ||||| ||||||  |||||||||||  ||||||| |||| || ||||||||| | ||||||| ||||||||||    
21375372 agggaacaacatttgaccagtgcgcatgcttctacgcatgagtcggattagtcgtccatctttgatggatcggaaaccagtgcgaaagc 21375460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #49
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 61 - 117
Target Start/End: Original strand, 36783296 - 36783352
Alignment:
61 tacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||||| |||||||| |||| |||| ||| |||||||||||||||||| |||||    
36783296 tacgcatgagccggattagtcgtccaccattggtgggttggaaaccggtgcaaaagc 36783352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #50
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 30 - 117
Target Start/End: Original strand, 30349601 - 30349688
Alignment:
30 gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||| | ||||||||| |||||| ||||| |||||| | | |||| |||| |||||| | ||||  ||||||||||||||||||    
30349601 gggaacaatgattggccagtgcgcatgcctctatgcatgagctgaattagtcgtccaccttaggtgggccggaaaccggtgcgaaagc 30349688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #51
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 30 - 92
Target Start/End: Complemental strand, 14974409 - 14974347
Alignment:
30 gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttg 92  Q
    |||||||||  ||||||||| | |||| |||||||||||| |||||||| |||| ||||||||    
14974409 gggaacaacatttggccagtgcacatgcctctacgcatgagccggattagtcgtccacctttg 14974347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #52
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 19 - 56
Target Start/End: Original strand, 1899012 - 1899049
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatg 56  Q
    |||||||||| |||||||||||||||||||| ||||||    
1899012 cgattcccagggggaacaacgcttggccagtgcgcatg 1899049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #53
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 36 - 117
Target Start/End: Original strand, 24499010 - 24499091
Alignment:
36 aacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||||  |||| |||||| ||||||| | || |||||||||| || || ||||| |||||||||||  |||||||||||    
24499010 aacgcttgatcagtgcgcatgcctctacgtacgagccggattaatagtccatctttggtgggttggaaattggtgcgaaagc 24499091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #54
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 32 - 117
Target Start/End: Complemental strand, 24653894 - 24653810
Alignment:
32 gaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||| ||||| |||| |||||  |||||||||| | ||||||||||||| |||| ||| ||||| | |||||| |||||||||    
24653894 gaacaacacttggtcagtgcgcatacctctacgcat-agccggattaatcgtccaccattggtgggtcgaaaaccgatgcgaaagc 24653810  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #55
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 31 - 80
Target Start/End: Original strand, 25467433 - 25467482
Alignment:
31 ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaat 80  Q
    ||||||||| |||||||||||||||| ||||||||| || | ||||||||    
25467433 ggaacaacgattggccagtacgcatgcctctacgcacgagctggattaat 25467482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #56
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 30 - 66
Target Start/End: Complemental strand, 35403597 - 35403561
Alignment:
30 gggaacaacgcttggccagtacgcatgtctctacgca 66  Q
    |||||||||||||||||| | ||||||||||||||||    
35403597 gggaacaacgcttggccaatgcgcatgtctctacgca 35403561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 62; Significance: 7e-27; HSPs: 53)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 19 - 116
Target Start/End: Complemental strand, 38578963 - 38578866
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    |||||||||| |||||||||||||||||||| |||||| |||||||||||| |||||||| |||  |||||||| ||||| |||||||||||||||||    
38578963 cgattcccagggggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag 38578866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 21 - 117
Target Start/End: Original strand, 13095873 - 13095969
Alignment:
21 attcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||| ||||||||| |||||||||| |||||| |||||||||||| |||||||| ||| ||||||||| ||||| |||||||||||| |||||    
13095873 attcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgctcacctttggtgggtcggaaaccggtgcaaaagc 13095969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 19 - 114
Target Start/End: Original strand, 18785682 - 18785777
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaa 114  Q
    ||||||| || ||||||||| |||||||||| |||||| |||||||||||||| |||||| |||||||||| || ||||| |||||||||||||||    
18785682 cgattcctagggggaacaacacttggccagtgcgcatgcctctacgcatgaactggattagtcgttcacctctggtgggtcggaaaccggtgcgaa 18785777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 17748478 - 17748380
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||| |||||||||||||||||||| |||||| ||||||| | || |||||||| |||| |||||||| ||||| |||||||| |||||||||    
17748478 cgattcccagggggaacaacgcttggccagtgcgcatgcctctacgtacgagccggattagtcgtccacctttgttgggtcggaaaccgatgcgaaagc 17748380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 43862068 - 43861970
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||| |||||||||| ||||||||| |||||| |||||||||||| |||||||| || |||||||||| ||| | | ||||||||||||||||    
43862068 cgattcccagggggaacaacgtttggccagtgcgcatgcctctacgcatgagccggattagtcattcacctttggtggatcgaaaaccggtgcgaaagc 43861970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 48804696 - 48804794
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||  ||||||||| |||||||||| |||||| |||||||||||| |||||||| |||| |||| ||| ||||| ||||||||||||||||||    
48804696 cgattcccaaggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgtccaccattggtgggtcggaaaccggtgcgaaagc 48804794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 31 - 117
Target Start/End: Complemental strand, 22993451 - 22993365
Alignment:
31 ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||||||||||||  ||||| ||||||||| ||||||||||| ||| ||||||||| |||||  |||||||||||||||||    
22993451 ggaacaacgcttggccagtgtgcatgcctctacgcacgaaccggattagtcgctcacctttggtgggtcagaaaccggtgcgaaagc 22993365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 23 - 117
Target Start/End: Original strand, 39420854 - 39420948
Alignment:
23 tcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||| ||||||||||||||||||||| ||| || |||||||||||| |||||||| ||||  ||||||||||||  |||||||||||| |||||    
39420854 tcccaaagggaacaacgcttggccagtgcgcgtgcctctacgcatgagccggattagtcgtctacctttgatgggccggaaaccggtgcaaaagc 39420948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 19 - 116
Target Start/End: Original strand, 27028292 - 27028389
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    ||||| |||| ||||||||| |||||||||| |||||| |||||| ||||| | |||||| ||| ||||||||| ||||| |||||||||||||||||    
27028292 cgatttccagggggaacaacacttggccagtgcgcatgcctctacacatgagctggattagtcgctcacctttggtgggtcggaaaccggtgcgaaag 27028389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 1797473 - 1797571
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||| || ||||||||||||||||| |||||||||||||||| || ||||| || |||| || ||||||||| | | |||||||||| |||||    
1797473 cgattcccaggggaaacaacgcttggccagtgcgcatgtctctacgcacgagccggactagtcgtccatctttgatggatcgaaaaccggtgcaaaagc 1797571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 10047972 - 10047874
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||| ||||||||| |||||||||| |||| | |||||||||||| | | |||| |||| |||| ||| ||||| ||||||||||||||||||    
10047972 cgattcccagggggaacaacacttggccagtgcgcaggcctctacgcatgagcagaattagtcgtccaccattggtgggtcggaaaccggtgcgaaagc 10047874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 37514945 - 37515031
Alignment:
30 gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    |||||||||| |||| |||| |||||||||||||||| || |||||||||||||||||| ||  ||||| ||||||||||| |||||    
37514945 gggaacaacgtttggtcagtgcgcatgtctctacgcacgagccggattaatcgttcaccattagtgggtcggaaaccggtgtgaaag 37515031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 47341889 - 47341987
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||| ||||||||| |||||||||| |||||| ||||||||| || | |||||  ||||||||| ||| ||||| ||||| ||||||||||||    
47341889 cgattcccagggggaacaacacttggccagtgcgcatgcctctacgcacgagcaggattggtcgttcaccattggtgggtcggaaatcggtgcgaaagc 47341987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 32 - 117
Target Start/End: Original strand, 48551883 - 48551968
Alignment:
32 gaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||| ||||||| | |||||| ||||||| |||| |||||||| |||| |||||||||||| | ||||||||||||||||||    
48551883 gaacaacggttggccaatgcgcatgcctctacgtatgagccggattagtcgtccacctttgatggatcggaaaccggtgcgaaagc 48551968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 31 - 107
Target Start/End: Complemental strand, 19914787 - 19914711
Alignment:
31 ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccg 107  Q
    ||||||||||||||||| | |||||| |||||||||||| || |||||||||  |||||||||||||||| ||||||    
19914787 ggaacaacgcttggccaatgcgcatgcctctacgcatgagccagattaatcgcccacctttgatgggttgtaaaccg 19914711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 29 - 116
Target Start/End: Original strand, 41945496 - 41945583
Alignment:
29 agggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    |||||| |||||||||||||| |||||| ||||||||| || |||||||| |||| |||||||| || || ||||| |||||||||||    
41945496 agggaataacgcttggccagtgcgcatgcctctacgcacgagccggattagtcgtccacctttggtgagtcggaaatcggtgcgaaag 41945583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 1605954 - 1606052
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||| |||| |||||||||||||||||||| | |||| ||||| || ||| |||||||| |||  |||||||| ||| | ||||||||||||||||||    
1605954 cgatttccagggggaacaacgcttggccagtgcacatgcctctaggcttgagccggattagtcgcccacctttggtggatcggaaaccggtgcgaaagc 1606052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 22573836 - 22573922
Alignment:
30 gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    |||||||||  ||| ||||| |||||| || ||||||||| ||||||||||||| || | ||||||||||| |||||||||||||||    
22573836 gggaacaacatttgaccagtgcgcatgcctttacgcatgagccggattaatcgtccatcattgatgggttgaaaaccggtgcgaaag 22573922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 22973980 - 22974078
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||| ||| ||||||||||||||||||||  |||||  ||||||||||| || ||||| |||| |||||||| |||||  |||||||| ||||||||    
22973980 cgattctcagggggaacaacgcttggccagtgtgcatgcgtctacgcatgagccagattagtcgtccacctttggtgggtcagaaaccggcgcgaaagc 22974078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 19 - 115
Target Start/End: Complemental strand, 26423383 - 26423288
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaa 115  Q
    |||||||||| || ||||||||||||||||| | | || ||||||||| || || ||||| ||||||||||||| | ||| ||||||||||||||||    
26423383 cgattcccaggggaaacaacgcttggccagtgcacctgcctctacgcacgagccagattagtcgttcacctttggt-ggtcggaaaccggtgcgaaa 26423288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 41 - 116
Target Start/End: Original strand, 3353459 - 3353534
Alignment:
41 ttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    ||||||||| |||||| ||||||||| || |||||||| |||| |||||||||||| |  ||||||||||||||||    
3353459 ttggccagtgcgcatgcctctacgcacgagccggattagtcgtccacctttgatggatcagaaaccggtgcgaaag 3353534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 30 - 117
Target Start/End: Original strand, 28744186 - 28744273
Alignment:
30 gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||| |||||||||||||||||  ||||||  | || |||||||| |||| |||||||| ||||| |||||| |||||||||||    
28744186 gggaacaatgcttggccagtacgcatacctctacatacgagccggattagtcgtccacctttggtgggtcggaaactggtgcgaaagc 28744273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 30 - 117
Target Start/End: Original strand, 39474964 - 39475051
Alignment:
30 gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||||||||||| |||| |||||  |||||||||||| |||||||| |||| |||||||  ||||| | ||||| ||||||||||    
39474964 gggaacaacgcttggtcagtgcgcatacctctacgcatgagccggattagtcgtccacctttagtgggtcgaaaaccagtgcgaaagc 39475051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 20 - 111
Target Start/End: Complemental strand, 45960098 - 45960007
Alignment:
20 gattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgc 111  Q
    ||||||||  || |||||| ||||| |||| |||||| |||||||||| | |||||||| ||| ||||||||||||| | ||||||||||||    
45960098 gattcccaagggcaacaacacttggtcagtgcgcatgcctctacgcataagccggattagtcgctcacctttgatggatcggaaaccggtgc 45960007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 46 - 116
Target Start/End: Original strand, 3603397 - 3603467
Alignment:
46 cagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    |||| |||||| ||||||||| || ||||||||||||||||| |||| ||||| ||||| |||||||||||    
3603397 cagtgcgcatgcctctacgcacgagccggattaatcgttcacttttggtgggtcggaaatcggtgcgaaag 3603467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 31 - 117
Target Start/End: Complemental strand, 4195286 - 4195200
Alignment:
31 ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||||  ||||| ||| |||||| |||||||||||| ||||||||  ||| |||| ||| |||||||||||||| |||||||||    
4195286 ggaacaacatttggctagtgcgcatgcctctacgcatgagccggattagccgtccaccattggtgggttggaaaccgatgcgaaagc 4195200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 134 - 200
Target Start/End: Complemental strand, 6454043 - 6453977
Alignment:
134 gtcttaagcccaaactaaagcatcacagataaatggtgcatataattacatgtgtcacttagctcat 200  Q
    |||||||||| ||||||||||||| ||||||||||||  | ||||||||||||||||| || |||||    
6454043 gtcttaagccaaaactaaagcatctcagataaatggtagaaataattacatgtgtcacataactcat 6453977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 31 - 117
Target Start/End: Original strand, 14650342 - 14650428
Alignment:
31 ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||| ||||| ||||| |  ||| |||||||||||| |||| ||| ||| ||||||||| ||||||| ||||||||||||||||    
14650342 ggaacaatgcttgaccagtgcatatgcctctacgcatgagccgggttagtcgctcacctttggtgggttgaaaaccggtgcgaaagc 14650428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 29151953 - 29152051
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||||||   |||||||| ||| ||||| |||||| |||||| || || |||||||||||||  ||| ||||||||| |||||||| |||||||||    
29151953 cgattcccaggaagaacaacgtttgaccagtgcgcatgcctctacacacgatccggattaatcgtctaccattgatgggtcggaaaccgatgcgaaagc 29152051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 42210358 - 42210260
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||| |  ||||||| ||||||||| |||||| ||||||||| || |||||||||||   |||| ||| ||||| |||||||| |||||||||    
42210358 cgattcccagtgaaaacaacgtttggccagtgcgcatgcctctacgcacgagccggattaatcacccaccgttggtgggtcggaaaccgatgcgaaagc 42210260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 43925525 - 43925623
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||| ||||||||| ||||| |||| |||||| |||||||||||| | |||||| | ||| ||||||||||| |  ||||||| || ||||||    
43925525 cgattcccagggggaacaacacttggtcagtgcgcatgcctctacgcatgagctggattagttgtttacctttgatggatcagaaaccgatgtgaaagc 43925623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 29 - 117
Target Start/End: Complemental strand, 24969412 - 24969324
Alignment:
29 agggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||| |||||||||| ||| || ||||||| |  |  ||||||||||| ||| ||||||||| | ||||||||||||||||||    
24969412 agggaacaacacttggccagtgcgcgtgcctctacgtacaagtcggattaatcgctcatctttgatggctcggaaaccggtgcgaaagc 24969324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 19 - 115
Target Start/End: Complemental strand, 27875184 - 27875088
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaa 115  Q
    |||||||||| ||||| ||| |||||||||| | |||| ||||||||||||  || |||| |||| |||||||  ||||| | ||||||||||||||    
27875184 cgattcccagggggaataacacttggccagtgcacatgcctctacgcatgagtcgcattagtcgtccacctttagtgggtcgaaaaccggtgcgaaa 27875088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #34
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 30 - 117
Target Start/End: Complemental strand, 8734771 - 8734684
Alignment:
30 gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||| |||||| |||| |||||| ||| ||||| || || ||||| |||  |||||||| ||||| ||||||||||||||||||    
8734771 gggaacaatgcttgggcagtgcgcatgcctcaacgcacgagccagattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc 8734684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #35
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 30 - 117
Target Start/End: Original strand, 34659250 - 34659337
Alignment:
30 gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||||||| ||||| |||||| ||||||||| || |||||||| |||  |||| ||| || || | ||||||||||||||||    
34659250 gggaacaacgcttgaccagtgcgcatgcctctacgcacgagccggattagtcgcccaccattggtgtgtcgaaaaccggtgcgaaagc 34659337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #36
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 19 - 98
Target Start/End: Complemental strand, 36619350 - 36619271
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggt 98  Q
    |||||||||| ||||||||| |||| |||||  ||||| |||||||||||| |||||||| |||| |||| ||| |||||    
36619350 cgattcccagggggaacaacacttgtccagtgtgcatgcctctacgcatgagccggattagtcgtccaccattggtgggt 36619271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #37
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 20247255 - 20247169
Alignment:
30 gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    ||||||||||||||| |||||| |||||||||||| | |   ||||||| |||| |||| ||||| ||||||||||| || ||||||    
20247255 gggaacaacgcttgggcagtacacatgtctctacgtacgggtcggattagtcgtccaccattgataggttggaaaccagtacgaaag 20247169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #38
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 23658192 - 23658290
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||| |||| ||||||||||||||||||||  ||||| |||||| || || |||||||| |||| || ||||| |||||  |||||| |||| |||||    
23658192 cgatttccagggggaacaacgcttggccagtgtgcatgcctctacacacgagccggattagtcgtccatctttggtgggtcagaaacctgtgcaaaagc 23658290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #39
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 29805525 - 29805439
Alignment:
30 gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    |||||||||| |||| |||| ||||||||||||||||||| ||  |||||||||  ||||||  || || ||||||| |||||||||    
29805525 gggaacaacgtttggtcagtgcgcatgtctctacgcatgagccaaattaatcgtctacctttagtgagtcggaaaccagtgcgaaag 29805439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #40
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 32823256 - 32823354
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||| ||||||||| ||||||| ||  | ||| ||||||||| || |||||||| |||   ||| ||||||||| |||||| |||||||||||    
32823256 cgattcccagggggaacaacacttggccggtgtgtatgcctctacgcacgagccggattagtcgcagaccattgatgggtcggaaacgggtgcgaaagc 32823354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #41
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 42032109 - 42032207
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||  |||||||||| ||||||||| | |||   ||||||||||| ||| |||| | || |||||||||||||| |||||||| ||| |||||    
42032109 cgattcccacggggaacaacgtttggccagtgcacatacatctacgcatgagccgaattagttgtccacctttgatgggtcggaaaccgatgctaaagc 42032207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #42
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 49142765 - 49142667
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||| || ||||||||||||| |||||| | |||| ||||||||| || |||||||| | |  |||||||||||||| | |||  |||||||||||    
49142765 cgattcctagggggaacaacgcttagccagtgcacatgcctctacgcacgagccggattagttgcccacctttgatgggtcgaaaattggtgcgaaagc 49142667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #43
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 32 - 93
Target Start/End: Original strand, 30827318 - 30827379
Alignment:
32 gaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttga 93  Q
    ||||||| ||||||||||||||||| ||||||||| || |||||||| ||||  ||||||||    
30827318 gaacaacacttggccagtacgcatgcctctacgcacgagccggattagtcgtctacctttga 30827379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #44
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 21 - 109
Target Start/End: Complemental strand, 28396254 - 28396166
Alignment:
21 attcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggt 109  Q
    |||| ||| ||||||||||||| ||  || |||||| || ||||||||| |||||||| ||||  ||||||| ||||| ||||||||||    
28396254 attctcagggggaacaacgcttagctggtgcgcatgcctttacgcatgagccggattagtcgtctacctttggtgggtcggaaaccggt 28396166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #45
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 51 - 117
Target Start/End: Complemental strand, 24983483 - 24983416
Alignment:
51 cgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggt-tggaaaccggtgcgaaagc 117  Q
    |||||| |||||||||||| |||||||| |||| |||| ||| ||||| ||||||||| |||||||||    
24983483 cgcatgcctctacgcatgagccggattagtcgtccaccattggtgggtctggaaaccgatgcgaaagc 24983416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #46
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 58 - 117
Target Start/End: Complemental strand, 48244413 - 48244354
Alignment:
58 ctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||||| |||||||| ||| ||||||||| ||| | | ||||||||||||||||    
48244413 ctctacgcatgagccggattagtcgctcacctttggtggatcgaaaaccggtgcgaaagc 48244354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #47
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 31 - 117
Target Start/End: Complemental strand, 5069899 - 5069813
Alignment:
31 ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||||| || |||  ||||| |||||||||  | |||||||| |||  |||||||| ||||| |||||||| |||||||||    
5069899 ggaacaacgcttagctagtgtgcatgcctctacgcacaagccggattagtcgcccacctttggtgggtcggaaaccgatgcgaaagc 5069813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #48
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 10317841 - 10317744
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||| ||||| ||| ||||| |||| || ||| ||||| |||| || | ||||| ||| ||||||||| ||| | ||||||||||||||||||    
10317841 cgattcccagggggaataacacttggtcagtgcgtatgcctctatgcat-aagcagattagtcgctcacctttggtggatcggaaaccggtgcgaaagc 10317744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #49
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 40 - 113
Target Start/End: Original strand, 38988934 - 38989006
Alignment:
40 cttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcga 113  Q
    ||||| |||| | |||| ||||||||||||||||||||| ||| ||| ||||| |||| | |||||||||||||    
38988934 cttggtcagtgcacatgcctctacgcatgaaccggattagtcgctcatctttggtggg-tcgaaaccggtgcga 38989006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #50
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 31 - 111
Target Start/End: Complemental strand, 5039502 - 5039422
Alignment:
31 ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgc 111  Q
    |||||||| ||||| |||| | |||  |||||||||||| |||||||| ||| ||||||||| ||| | | ||||||||||    
5039502 ggaacaacacttggtcagtgcacatacctctacgcatgagccggattagtcgctcacctttggtggatcgaaaaccggtgc 5039422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #51
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 135 - 191
Target Start/End: Complemental strand, 6464780 - 6464724
Alignment:
135 tcttaagcccaaactaaagcatcacagataaatggtgcatataattacatgtgtcac 191  Q
    ||||||||| |||||||||||||  |||||||||||  | |||||| ||||||||||    
6464780 tcttaagccaaaactaaagcatctaagataaatggtagagataattccatgtgtcac 6464724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #52
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 53 - 117
Target Start/End: Original strand, 32768984 - 32769048
Alignment:
53 catgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||| ||||||||| ||  ||||||| ||||||||||||| ||| | ||||||||||| ||||||    
32768984 catgcctctacgcacgagtcggattagtcgttcacctttggtggatcggaaaccggtgtgaaagc 32769048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #53
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 132 - 200
Target Start/End: Complemental strand, 44943133 - 44943065
Alignment:
132 tggtcttaagcccaaactaaagcatcacagataaatggtgcatataattacatgtgtcacttagctcat 200  Q
    |||||||||||| |||| |||||||| || |||||||  | | |||||||||||||||| |||| ||||    
44943133 tggtcttaagccgaaaccaaagcatctcatataaatgaagtaaataattacatgtgtcatttaggtcat 44943065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 60; Significance: 1e-25; HSPs: 52)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 20 - 111
Target Start/End: Original strand, 10669603 - 10669694
Alignment:
20 gattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgc 111  Q
    ||||||||| | |||||||||||||||||| |||||||||||||||| ||  ||||||||||||||||||||| ||||| ||||||||||||    
10669603 gattcccagggagaacaacgcttggccagtgcgcatgtctctacgcacgagtcggattaatcgttcacctttggtgggtcggaaaccggtgc 10669694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 25540500 - 25540402
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||| || |||||||||||||||||||| |||||| ||||||||| || |||||||| |||| |||||||| ||||| ||||||||||||||||||    
25540500 cgattcctagggggaacaacgcttggccagtgcgcatgcctctacgcacgagccggattagtcgtccacctttggtgggtcggaaaccggtgcgaaagc 25540402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 41220645 - 41220743
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||||||  ||||||||||||||||||| |||||| |||||||||||| ||| |||| ||||||||||||  ||||| ||||||||||||||||||    
41220645 cgattcccaggaggaacaacgcttggccagtgcgcatgcctctacgcatgagccgaattagtcgttcacctttagtgggtcggaaaccggtgcgaaagc 41220743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 31 - 116
Target Start/End: Original strand, 38962785 - 38962870
Alignment:
31 ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    ||||||||||||||||||| |||||| ||||||||||||||||||||| |||| |||||||| |||||  ||||| ||||||||||    
38962785 ggaacaacgcttggccagtgcgcatgcctctacgcatgaaccggattagtcgtccacctttggtgggtcagaaactggtgcgaaag 38962870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 19 - 98
Target Start/End: Complemental strand, 45263763 - 45263684
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggt 98  Q
    ||||||||||||||||||||||||||||||| |||||| ||||||||| || |||||||||||| ||| ||||| |||||    
45263763 cgattcccagagggaacaacgcttggccagtgcgcatgcctctacgcacgagccggattaatcgctcatctttggtgggt 45263684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 31 - 117
Target Start/End: Original strand, 7747296 - 7747382
Alignment:
31 ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||||| |||||||||  ||||| |||||||||||| |||||||| ||||||||||||  ||||| ||||||||||||||||||    
7747296 ggaacaacgtttggccagtgtgcatgcctctacgcatgagccggattagtcgttcacctttagtgggtcggaaaccggtgcgaaagc 7747382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 16325605 - 16325703
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||| ||||||||| ||||||||||  ||||| |||||||||||| || ||||| |||| |||| ||| ||||| ||||||||||||||||||    
16325605 cgattcccagggggaacaacacttggccagtgtgcatgcctctacgcatgagccagattagtcgtccaccattggtgggtcggaaaccggtgcgaaagc 16325703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 31 - 117
Target Start/End: Complemental strand, 20116696 - 20116610
Alignment:
31 ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||| |||||| | |||||| |||||||||||| ||||||||  ||| |||||||||||||| ||||||||||||||||||    
20116696 ggaacaacgcatggccaatgcgcatgcctctacgcatgagccggattagccgtccacctttgatgggtcggaaaccggtgcgaaagc 20116610  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 22593145 - 22593241
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||| |||||||||| ||||||||| |||||| |||||||||||| |||||||| |||| |||||||| ||||| || |||||||||||||||    
22593145 cgattcccagggggaacaacg-ttggccagtgcgcatgcctctacgcatgagccggattagtcgtccacctttggtgggtcgg-aaccggtgcgaaagc 22593241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 19 - 116
Target Start/End: Original strand, 2550878 - 2550975
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    ||||||||||  |||||||| ||| |||||| ||||||||||||||||||| |||||||| |||  ||| |||| ||||||| |||||||||||||||    
2550878 cgattcccaggaggaacaacacttagccagtgcgcatgtctctacgcatgagccggattagtcgcccacttttggtgggttgaaaaccggtgcgaaag 2550975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 20 - 117
Target Start/End: Original strand, 10823071 - 10823168
Alignment:
20 gattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||  ||||||||||||||||||| |||||| ||||||||| || |||||||| |||  |||||||  ||||| ||||||||||||||||||    
10823071 gattcccaggaggaacaacgcttggccagtgcgcatgcctctacgcacgagccggattagtcgcccaccttttgtgggtcggaaaccggtgcgaaagc 10823168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 19 - 106
Target Start/End: Original strand, 331511 - 331598
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaacc 106  Q
    |||||||||| ||||||||| |||||||||| ||||||  ||||||||||| |||||||| |||  |||||||| |||||||||||||    
331511 cgattcccagggggaacaacacttggccagtgcgcatgcttctacgcatgagccggattagtcgcccacctttggtgggttggaaacc 331598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 30 - 117
Target Start/End: Complemental strand, 34346372 - 34346285
Alignment:
30 gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||||| ||||||||||  ||||| ||||||||||||  | ||||||||| ||||||||| ||||| ||||||||||||||||||    
34346372 gggaacaacacttggccagtgtgcatgcctctacgcatgagtcagattaatcgctcacctttggtgggtcggaaaccggtgcgaaagc 34346285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 30 - 117
Target Start/End: Original strand, 37560194 - 37560281
Alignment:
30 gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||| |||| |||| |||||| ||||||||| || ||||||||||||| |||||||||||||| | ||||||||| ||||||    
37560194 gggaacaacgtttggtcagtgcgcatgcctctacgcacgagccggattaatcgtccacctttgatgggtcgaaaaccggtgtgaaagc 37560281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 19 - 110
Target Start/End: Complemental strand, 39201604 - 39201513
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtg 110  Q
    |||||| ||| |||||||| | |||||||||  ||||| |||||||||||| |||||||| ||||||||||||| ||||| |||||||||||    
39201604 cgattctcagggggaacaatgtttggccagtgtgcatgcctctacgcatgagccggattagtcgttcacctttggtgggtcggaaaccggtg 39201513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 31 - 117
Target Start/End: Complemental strand, 3643971 - 3643885
Alignment:
31 ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||||||||||||||| |||||| |||||||||||| | |||||| |||| |||||||| ||||  |||||||| |||||||||    
3643971 ggaacaacgcttggccagtgcgcatgcctctacgcatgagctggattagtcgtccacctttggtgggccggaaaccgttgcgaaagc 3643885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 3811787 - 3811689
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||||||||||||| ||||| || | |||||| |||||||||||| |||||||| |||  |||||||| |||||  ||||||| |||||||||    
3811787 cgattcccagagggaacaacacttggtcaatgcgcatgcctctacgcatgagccggattactcgcccacctttggtgggtcagaaaccgatgcgaaagc 3811689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 5035298 - 5035396
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||||   ||||| ||||| ||||| |||||||||||||||| |||||||||||||| | ||||||| |||||| |||||||  |||||||||    
5035298 cgattcccagaaaaaacaatgcttgaccagtgcgcatgtctctacgcacgaaccggattaatcatccacctttaatgggtcggaaacccatgcgaaagc 5035396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 8410141 - 8410239
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||| ||||||||| |||||||||| |||||| ||||||||| || |||||||| |||  ||| ||||  |||| ||||||||||||||||||    
8410141 cgattcccagggggaacaacacttggccagtgcgcatgcctctacgcacgagccggattagtcgcccacttttggggggtcggaaaccggtgcgaaagc 8410239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 12455320 - 12455418
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||| |||| || |||||||||| |||||| |||||| ||||||||| || |||||||| ||| ||||| ||| ||||| ||||||||||||||||||    
12455320 cgatttccaggggaaacaacgcttagccagtgcgcatgcctctacgcacgagccggattagtcgctcaccattggtgggtcggaaaccggtgcgaaagc 12455418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 14169694 - 14169608
Alignment:
30 gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    ||||||||| |||| ||||| ||||||||||||||||||| |||||||| ||||  ||| ||| ||||| |||||||||||||||||    
14169694 gggaacaacacttgaccagtgcgcatgtctctacgcatgagccggattagtcgtctaccattggtgggtcggaaaccggtgcgaaag 14169608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 18902626 - 18902528
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||  |||||||||||||| ||||| ||| |||||||||||| || || ||||| |||  |||||||| ||||| ||||||||||||||||||    
18902626 cgattcccacggggaacaacgcttgaccagtgcgcgtgtctctacgcacgagccagattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc 18902528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 38005412 - 38005510
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||  |||||||||||||||||||| |||||| |||||| ||||| |||||||| |||  |||||||| ||| | |||||| |||||||||||    
38005412 cgattcccaaggggaacaacgcttggccagtgcgcatgcctctacacatgagccggattagtcgcccacctttggtggatcggaaactggtgcgaaagc 38005510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 44139494 - 44139592
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||| |||||||||||||||||||| ||| || ||||||||| || |||||||| |||  ||||  || ||||| ||||||||||||||||||    
44139494 cgattcccagggggaacaacgcttggccagtgcgcgtgcctctacgcacgagccggattagtcgcccaccaatggtgggtcggaaaccggtgcgaaagc 44139592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 19 - 116
Target Start/End: Complemental strand, 6358247 - 6358150
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    ||||| |||| ||||||||| |||||||||| |||||| |||||||||||| |||||||| |||| |||| ||| ||||| | ||||||||| |||||    
6358247 cgatttccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgtccaccattggtgggtcgaaaaccggtgtgaaag 6358150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 21 - 117
Target Start/End: Complemental strand, 42770745 - 42770649
Alignment:
21 attcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||| ||| |||||||||||||||||||| |||||| |||| |||| || ||||||||||||| |||||||| ||||| | |||||| ||| |||||    
42770745 attctcagggggaacaacgcttggccagtgcgcatgcctcttcgcacgagccggattaatcgtccacctttggtgggtcgaaaaccgatgcaaaagc 42770649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 19 - 114
Target Start/End: Original strand, 34356216 - 34356311
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaa 114  Q
    ||||| |||| ||||||||| ||||| |||| |||||| ||||| |||||| ||||||||||||| |||| ||||||||| ||||||  |||||||    
34356216 cgatttccagggggaacaacacttggtcagtgcgcatgcctctatgcatgagccggattaatcgtgcaccattgatgggtcggaaacgagtgcgaa 34356311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 19 - 105
Target Start/End: Complemental strand, 10026712 - 10026626
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaac 105  Q
    |||||| ||| |||||||||| ||||||||| |||||| |||||||||||| |||||||| |||  |||||||| ||||| ||||||    
10026712 cgattctcagggggaacaacgtttggccagtgcgcatgcctctacgcatgagccggattagtcgaccacctttggtgggtcggaaac 10026626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 33005772 - 33005858
Alignment:
30 gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    ||||||||| |||||||||| |||||| ||||||||||||  | ||||||||| ||||||||  ||||| |||||||| ||||||||    
33005772 gggaacaacacttggccagtgcgcatgcctctacgcatgaggcagattaatcgctcacctttagtgggtcggaaaccgatgcgaaag 33005858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 34722690 - 34722788
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||| ||| | ||||||||||||| |||| | |||||||||||||| || |||||||| |||  |||||||||||| |  |||||||||||||||||    
34722690 cgattctcagggagaacaacgcttggtcagtgcacatgtctctacgcacgagccggattagtcgcccacctttgatggatcagaaaccggtgcgaaagc 34722788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 19 - 116
Target Start/End: Original strand, 12864234 - 12864331
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    ||||| |||| ||||||||| ||||| |||| |||||| |||| ||||||| || ||||| |||| |||| ||| ||||| |||||||||||||||||    
12864234 cgatttccagggggaacaacacttggtcagtgcgcatgcctctgcgcatgagccagattagtcgtccaccattggtgggtcggaaaccggtgcgaaag 12864331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 115
Target Start/End: Complemental strand, 20612622 - 20612534
Alignment:
28 gagggaacaacgcttggccagtacgcatgtctctacgcatgaacc-ggattaatcgttcacctttgatgggttggaaaccggtgcgaaa 115  Q
    ||||||||||| |||||||||| |||||| ||||| |||||| || |||||| |||| |||| ||| ||||| ||||||||||||||||    
20612622 gagggaacaacacttggccagtgcgcatgcctctatgcatgagccgggattagtcgtccaccattggtgggtcggaaaccggtgcgaaa 20612534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #33
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 33 - 116
Target Start/End: Complemental strand, 3848996 - 3848913
Alignment:
33 aacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    ||||||| ||||||||  |||||||||||||||| ||  ||||||| ||||||||||||||||||| | |||  ||||||||||    
3848996 aacaacgtttggccagggcgcatgtctctacgcacgagtcggattagtcgttcacctttgatgggtcgaaaattggtgcgaaag 3848913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #34
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 30 - 117
Target Start/End: Original strand, 24179589 - 24179676
Alignment:
30 gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||| ||||||||| | |||| |||||||||||| |||||||| |||| || ||||| ||||||  |||||||||| |||||    
24179589 gggaacaacgtttggccagtgcacatgcctctacgcatgagccggattagtcgtccatctttggtgggttaaaaaccggtgcaaaagc 24179676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #35
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 33 - 116
Target Start/End: Original strand, 44773287 - 44773370
Alignment:
33 aacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    ||||||| |||||||||  ||||| ||||  || ||| |||||||| ||| ||||||||||||||| |||||||||||||||||    
44773287 aacaacgtttggccagtgtgcatgcctctgtgcgtgagccggattagtcgctcacctttgatgggtcggaaaccggtgcgaaag 44773370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #36
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 29422225 - 29422323
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||| |||||||||||||| |||||||| |  ||||  || |||||| || |||||||| |||| |||||||||||| | ||||| ||||||||||||    
29422225 cgatttccagagggaacaacacttggccaatgagcatacctttacgcacgagccggattagtcgtccacctttgatggatcggaaatcggtgcgaaagc 29422323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #37
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 35946759 - 35946845
Alignment:
30 gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    |||||||||||||||||| |  ||||| ||||||||| || |||||||| |||| |||| ||| ||||| |||||| ||||||||||    
35946759 gggaacaacgcttggccattgtgcatgcctctacgcacgagccggattagtcgtccaccattggtgggtcggaaactggtgcgaaag 35946845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #38
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 20 - 117
Target Start/End: Original strand, 44945605 - 44945701
Alignment:
20 gattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||||| ||||||||||||  ||| |||||| ||||||||| || |||||||| |||  |||||||  ||| | ||||||||||||||||||    
44945605 gattcccagagg-aacaacgcttggatagtgcgcatgcctctacgcacgagccggattagtcgcccacctttagtggatcggaaaccggtgcgaaagc 44945701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #39
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 41 - 116
Target Start/End: Complemental strand, 18649100 - 18649025
Alignment:
41 ttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    |||| |||| |||||| ||||||||||||  ||||||| ||| |||| |||| |||||||||||||| ||||||||    
18649100 ttgggcagtgcgcatgcctctacgcatgagtcggattagtcgctcacttttggtgggttggaaaccgttgcgaaag 18649025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #40
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 2528437 - 2528339
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||| ||||||||||||||| ||||  ||||| |||||| ||| | |||||||| ||| ||| ||||  || || |||||| |||||||||||    
2528437 cgattcccagggggaacaacgcttggtcagtgtgcatgcctctacacataagccggattagtcgctcatctttagtgagtcggaaactggtgcgaaagc 2528339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #41
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 16813250 - 16813164
Alignment:
30 gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    |||||||||| ||| |||||||||||| ||||| ||| || |||||||| |||| || ||||| | ||||||||| | |||||||||    
16813250 gggaacaacgtttgaccagtacgcatgcctctatgcacgagccggattagtcgtccatctttggtaggttggaaatcagtgcgaaag 16813164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #42
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 16852529 - 16852443
Alignment:
30 gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    |||||||||| ||| |||||||||||| ||||| ||| || |||||||| |||| || ||||| | ||||||||| | |||||||||    
16852529 gggaacaacgtttgaccagtacgcatgcctctatgcacgagccggattagtcgtccatctttggtaggttggaaatcagtgcgaaag 16852443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #43
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 27 - 116
Target Start/End: Complemental strand, 9360836 - 9360747
Alignment:
27 agagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    ||||| ||||||| ||||||||| |||||| ||||||||| || ||| |||| |||  |||||||  ||||  |||||||||||||||||    
9360836 agaggaaacaacgtttggccagtgcgcatgcctctacgcacgagccgaattagtcgcccacctttagtgggccggaaaccggtgcgaaag 9360747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #44
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 31 - 116
Target Start/End: Original strand, 16034959 - 16035044
Alignment:
31 ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    ||||||||||||| |||||  ||||| || |||| | || |||||||| ||| ||||| |||||| || |||||||||||||||||    
16034959 ggaacaacgcttgaccagtgtgcatgcctatacgtacgagccggattagtcgctcaccattgatgagtcggaaaccggtgcgaaag 16035044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #45
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 19 - 116
Target Start/End: Original strand, 21286454 - 21286551
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    ||||||||||  | ||||||||||| ||||| |||||| ||||||||| || | |||||| ||  ||| | ||| |||||||||||||||||| ||||    
21286454 cgattcccaggcgaaacaacgcttgaccagtgcgcatgcctctacgcacgagctggattagtcactcatcattggtgggttggaaaccggtgcaaaag 21286551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #46
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 7787066 - 7787158
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgc 111  Q
    ||||| |||| ||||||||  ||||||||||||||||| ||||||||| || |||||||| |||  || ||||| ||| | | ||||||||||    
7787066 cgatttccagggggaacaatacttggccagtacgcatgcctctacgcacgagccggattagtcgcccatctttggtggatcgaaaaccggtgc 7787158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #47
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 30 - 117
Target Start/End: Complemental strand, 31596517 - 31596430
Alignment:
30 gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||| | ||||||||| | |||   ||||||||||| | | |||||||||  ||||||||||  ||||||||||||||||||||    
31596517 gggaacaatgtttggccagtgcacatacttctacgcatgagctgaattaatcgtctacctttgatgaattggaaaccggtgcgaaagc 31596430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #48
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 32 - 69
Target Start/End: Complemental strand, 13104908 - 13104871
Alignment:
32 gaacaacgcttggccagtacgcatgtctctacgcatga 69  Q
    |||||||||||||||||| |||||| ||||||||||||    
13104908 gaacaacgcttggccagtgcgcatgcctctacgcatga 13104871  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #49
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 31 - 116
Target Start/End: Original strand, 27725962 - 27726047
Alignment:
31 ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    ||||||| ||||||||||| |||||| |||||||||  | |||||||| |||  ||||  || ||||| ||||||||||| |||||    
27725962 ggaacaatgcttggccagtgcgcatgcctctacgcactagccggattagtcgcccaccaatggtgggtcggaaaccggtgtgaaag 27726047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #50
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 30 - 115
Target Start/End: Complemental strand, 43303377 - 43303292
Alignment:
30 gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaa 115  Q
    |||||||||||||| |||||||||||| ||||| ||| || | ||||||||||  || |  ||||||||  |||| ||||||||||    
43303377 gggaacaacgcttgaccagtacgcatgcctctatgcacgagctggattaatcgcccatcaatgatgggtcagaaatcggtgcgaaa 43303292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #51
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 51 - 115
Target Start/End: Original strand, 21641992 - 21642056
Alignment:
51 cgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaa 115  Q
    |||||| |||||||||||| ||| ||||||||  | |||||| ||||| | ||||||||||||||    
21641992 cgcatgcctctacgcatgagccgaattaatcgcccgcctttggtgggtcgaaaaccggtgcgaaa 21642056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #52
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 61 - 117
Target Start/End: Original strand, 44023347 - 44023403
Alignment:
61 tacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||  || |||| |||| || ||||| ||||||||||||||||||||||||    
44023347 tacgcatgagtcgaattagtcgtccatctttggtgggttggaaaccggtgcgaaagc 44023403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 59; Significance: 4e-25; HSPs: 63)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 7650237 - 7650335
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||| |||| ||||||||| ||||||||||||| ||||||||||||| || |||||||| |||  |||||||| ||||||||||||||||||||||||    
7650237 cgatttccagggggaacaacacttggccagtacgaatgtctctacgcacgagccggattagtcgcccacctttggtgggttggaaaccggtgcgaaagc 7650335  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 47219154 - 47219252
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||  || ||||||||||||| ||| |||||| |||||||||||| |||||||| |||| |||||||||||||| ||||||||||||||||||    
47219154 cgattcccaagggaaacaacgcttggctagtgcgcatgcctctacgcatgagccggattagtcgtccacctttgatgggtcggaaaccggtgcgaaagc 47219252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 31 - 116
Target Start/End: Original strand, 54261248 - 54261333
Alignment:
31 ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    ||||||||||||||||||| |||||| |||||||||||| |||||||| ||||||||||||  ||||| |||||||||||||||||    
54261248 ggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgttcacctttagtgggtcggaaaccggtgcgaaag 54261333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 19 - 115
Target Start/End: Original strand, 53649737 - 53649833
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaa 115  Q
    |||||| ||| | ||||||| |||||||||| ||| ||||||||||||||| |||||||| ||||||||||||||||| | ||||||||||||||||    
53649737 cgattctcagggtgaacaacacttggccagtgcgcctgtctctacgcatgagccggattagtcgttcacctttgatggatcggaaaccggtgcgaaa 53649833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 20 - 115
Target Start/End: Complemental strand, 3507629 - 3507534
Alignment:
20 gattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaa 115  Q
    |||||| |||||||||||| |||||||||| |||||| ||||||||| || |||||||| ||| ||||||||| ||||| ||||||||||||||||    
3507629 gattcctagagggaacaacacttggccagtgcgcatgcctctacgcacgagccggattagtcgctcacctttggtgggtcggaaaccggtgcgaaa 3507534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 28572308 - 28572210
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||| || |||||||||||||||||| ||||| ||||||||| || |||||||| |||  |||||||| ||||| ||||||||||||||||||    
28572308 cgattcccaggggaaacaacgcttggccagtatgcatgcctctacgcacgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc 28572210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 29135923 - 29136021
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||| ||||||||| |||||||||| |||||| |||||||||||| |||||||| || | |||| ||| |||||||||||||||| |||||||    
29135923 cgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcttccaccattggtgggttggaaaccggtacgaaagc 29136021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 19 - 116
Target Start/End: Original strand, 45877464 - 45877561
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    ||||| |||| || |||||| |||||||||| | |||| |||||||||||| |||||||| ||||||||| ||||||||| |||||||||||||||||    
45877464 cgatttccaggggaaacaacacttggccagtgcacatgcctctacgcatgagccggattagtcgttcaccattgatgggtcggaaaccggtgcgaaag 45877561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 31072888 - 31072986
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||| |||| ||||||||||||||| |||| | |||| ||||||||| || || |||||||||| |||||||| | ||||||||||||||||||||||    
31072888 cgatttccagggggaacaacgcttggtcagtgcacatgcctctacgcacgacccagattaatcgtccacctttggtaggttggaaaccggtgcgaaagc 31072986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 51060378 - 51060280
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||| ||| ||||||||| ||||| |||| |||||| |||||||||||||| |||||| |||| |||| ||| ||||| ||||||||||||||||||    
51060378 cgattctcagggggaacaacacttggtcagtgcgcatgcctctacgcatgaactggattagtcgtccaccattggtgggtcggaaaccggtgcgaaagc 51060280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 20 - 117
Target Start/End: Complemental strand, 55069775 - 55069678
Alignment:
20 gattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||| | ||||||||||| ||||||||| | |||| ||||||||| || |||||||||||| ||||||||| ||||| |||||||||||| |||||    
55069775 gattcctatagggaacaacgtttggccagtgcacatgcctctacgcacgagccggattaatcgctcacctttggtgggtcggaaaccggtgcaaaagc 55069678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 33 - 117
Target Start/End: Original strand, 25294984 - 25295068
Alignment:
33 aacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||| |||||||||| |||||| ||||| |||||| |||||||| |||| |||| ||| ||||||||||||||||||||||||    
25294984 aacaacacttggccagtgcgcatgcctctatgcatgagccggattagtcgtccaccattggtgggttggaaaccggtgcgaaagc 25295068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 30 - 117
Target Start/End: Original strand, 23511588 - 23511675
Alignment:
30 gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||| ||||| ||| ||||| |||||| ||||||||||||  |||||||||||| |||||||||||||| | ||||||||||||||||    
23511588 gggagcaacgtttgaccagtgcgcatgcctctacgcatgagtcggattaatcgtccacctttgatgggtcgaaaaccggtgcgaaagc 23511675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 7328854 - 7328951
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||| ||||||||| |||||||||| |||||| || ||||||||| |||||||| |||  |||||||| ||||| | ||||||||||||||||    
7328854 cgattcccagggggaacaacacttggccagtgcgcatgcct-tacgcatgagccggattagtcgcccacctttggtgggtcgaaaaccggtgcgaaagc 7328951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 30 - 112
Target Start/End: Original strand, 10040577 - 10040659
Alignment:
30 gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcg 112  Q
    |||||||||||||||||||| |||||| ||||||||| || ||||| |  |||| |||||||| |||||||||||||||||||    
10040577 gggaacaacgcttggccagtgcgcatgcctctacgcacgagccggaatggtcgtccacctttggtgggttggaaaccggtgcg 10040659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 26043822 - 26043920
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||| | ||||||| |||||||||| |||||| |||||||||||| |||||||| ||| ||||||||| || ||  |||||||| ||||||||    
26043822 cgattcccagggagaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgctcacctttggtgagtcagaaaccggggcgaaagc 26043920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 30045831 - 30045929
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||| || |||||||||||||||||||| |||||||||||||||| ||  | ||||| |||| |||||||||||||| | ||||  ||||||||||    
30045831 cgattcctagggggaacaacgcttggccagtgcgcatgtctctacgcacgagtctgattagtcgtccacctttgatgggtcgtaaactagtgcgaaagc 30045929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 19 - 116
Target Start/End: Original strand, 35315966 - 35316063
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    |||||||||| ||||||||| |||||||||| |||||| |||||||||||| | |||||| |||  ||| |||| ||||| |||||||| ||||||||    
35315966 cgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagctggattagtcgcccacttttggtgggtcggaaaccgatgcgaaag 35316063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 31 - 111
Target Start/End: Complemental strand, 40660412 - 40660332
Alignment:
31 ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgc 111  Q
    ||||||||  |||| |||| |||||| |||||||||||||||||||||||| |||||||||| ||||| | ||||||||||    
40660412 ggaacaacatttggtcagtgcgcatgcctctacgcatgaaccggattaatcattcacctttggtgggtcgaaaaccggtgc 40660332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 21 - 117
Target Start/End: Original strand, 48342032 - 48342128
Alignment:
21 attcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||| || |||||||||||||||| ||| |||||| ||||||||||||||| ||||| |||| || ||||| ||| | |||||| |||||||||||    
48342032 attcctagggggaacaacgcttggctagtgcgcatgcctctacgcatgaaccagattagtcgtccatctttggtggatcggaaacaggtgcgaaagc 48342128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 19 - 103
Target Start/End: Complemental strand, 52364897 - 52364813
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaa 103  Q
    ||||||||||| ||||||||||||| ||||| |||||| ||||||||| || | |||||||||||  ||||||||||||| ||||    
52364897 cgattcccagaaggaacaacgcttgaccagtgcgcatgcctctacgcacgagctggattaatcgtctacctttgatgggtcggaa 52364813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 30 - 117
Target Start/End: Complemental strand, 3136780 - 3136693
Alignment:
30 gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||||| ||||| |||| |||||| ||||||||||||  ||||||| |||| |||||||| | ||| ||||||||||||||||||    
3136780 gggaacaacacttgggcagtgcgcatgcctctacgcatgagtcggattagtcgtccacctttggttggtcggaaaccggtgcgaaagc 3136693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 29127929 - 29128027
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||| |||| | ||||||| ||||| |||| |||||| |||||||||||| |||||||| |||  |||||||| ||||| |||||||| |||||||||    
29127929 cgatttccagggagaacaacacttggtcagtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccgatgcgaaagc 29128027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 33251672 - 33251770
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||| | |||||||||| |||||||||  ||||| |||||||||||| |||||||| |||| ||| |||||||||| | ||||  ||||||||||    
33251672 cgattcccggtgggaacaacgtttggccagtgtgcatgcctctacgcatgagccggattagtcgtccacatttgatgggtcgaaaacgagtgcgaaagc 33251770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 51 - 117
Target Start/End: Original strand, 44064586 - 44064652
Alignment:
51 cgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||| ||||||||||||||||||||| ||| ||||||||| ||||| |||||||||||| |||||    
44064586 cgcatgcctctacgcatgaaccggattagtcgctcacctttggtgggtcggaaaccggtgcaaaagc 44064652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 19 - 105
Target Start/End: Complemental strand, 45402448 - 45402362
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaac 105  Q
    ||||||| |||||||||||| || |||| || |||||| |||||||||||| |||||||| ||||||||||||  ||||| ||||||    
45402448 cgattcctagagggaacaacactcggcctgtgcgcatgcctctacgcatgagccggattagtcgttcacctttagtgggtcggaaac 45402362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 45450533 - 45450447
Alignment:
30 gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    |||||||| ||||| ||||| |||||| |||||||||| | |  ||||| |||| ||||||||||| ||||||||||||||||||||    
45450533 gggaacaatgcttgaccagtgcgcatgcctctacgcataagctagattagtcgtccacctttgatgagttggaaaccggtgcgaaag 45450447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 20 - 117
Target Start/End: Complemental strand, 26362063 - 26361966
Alignment:
20 gattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||||  |||||||||| |||| ||||  ||||| ||||||||| || |||||||| |||  |||||||||||||| ||||||||||| ||||||    
26362063 gattcccaaggggaacaacgtttggtcagtgtgcatgcctctacgcacgagccggattagtcgcacacctttgatgggtcggaaaccggtgtgaaagc 26361966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 19 - 116
Target Start/End: Complemental strand, 29762252 - 29762155
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    |||||| ||| || |||||| |||||||||| |||||| ||||| |||||| | |||||| |||| |||| ||| ||||| |||||||||||||||||    
29762252 cgattctcaggggcaacaacacttggccagtgcgcatgcctctatgcatgagctggattagtcgtccaccattggtgggtcggaaaccggtgcgaaag 29762155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 19 - 116
Target Start/End: Original strand, 47471842 - 47471938
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    |||||||||| |||||||| ||||||| ||| ||||||  ||||||||||| ||| |||| |||| |||||||| ||||| |||||||| ||||||||    
47471842 cgattcccag-gggaacaatgcttggctagtgcgcatgcttctacgcatgagccgaattagtcgtccacctttggtgggtcggaaaccgatgcgaaag 47471938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 32 - 117
Target Start/End: Original strand, 54237471 - 54237556
Alignment:
32 gaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||| ||||| |||| ||||||||||||||||||| |||||| | |||| |||| ||  ||||| ||||||||||||||||||    
54237471 gaacaacacttggtcagtgcgcatgtctctacgcatgagccggataagtcgtccaccattagtgggtcggaaaccggtgcgaaagc 54237556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 19 - 115
Target Start/End: Original strand, 6462422 - 6462518
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaa 115  Q
    |||||| ||| | |||||||||||||||||| |||||| |||||||||||| |||||||| |||  ||   ||  ||||||||||||||||||||||    
6462422 cgattcacagggagaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgaccattattagtgggttggaaaccggtgcgaaa 6462518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 20 - 116
Target Start/End: Original strand, 10855395 - 10855490
Alignment:
20 gattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    |||| |||| ||||||||||||||||||||||||||| ||||||||| |||||| |||| |||  || ||||| ||||||| ||| || ||||||||    
10855395 gatttccagggggaacaacgcttggccagtacgcatgcctctacgcacgaaccgaattagtcg-ccatctttgttgggttgaaaatcgatgcgaaag 10855490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 45 - 117
Target Start/End: Complemental strand, 49021274 - 49021202
Alignment:
45 ccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||| |||||| |||||||||||| |||||||| |||| |||| ||| ||||| ||||||||||||||||||    
49021274 ccagtgcgcatgcctctacgcatgagccggattagtcgtccaccattggtgggtcggaaaccggtgcgaaagc 49021202  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 92
Target Start/End: Original strand, 3755580 - 3755653
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttg 92  Q
    ||||||||||  ||||||||| ||| ||||| ||||||||||||||||||| |||||||| ||||  |||||||    
3755580 cgattcccaggaggaacaacgtttgaccagtgcgcatgtctctacgcatgagccggattagtcgtctacctttg 3755653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 31 - 116
Target Start/End: Original strand, 22909805 - 22909890
Alignment:
31 ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    ||||||||||| ||| ||| |||||   ||||||||||| ||| |||| |||| |||||||||||||| ||||||| |||||||||    
22909805 ggaacaacgctaggctagtgcgcatacttctacgcatgagccgaattagtcgtgcacctttgatgggtcggaaaccagtgcgaaag 22909890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 88
Target Start/End: Original strand, 49198361 - 49198430
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacc 88  Q
    ||||||| || ||||||||| |||||||||| |||||| |||||||||||| |||||||| |||| ||||    
49198361 cgattcctagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgtccacc 49198430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 33 - 117
Target Start/End: Original strand, 2668085 - 2668169
Alignment:
33 aacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||| |||||||||| |||||| ||||||||| || | |||||| ||| ||||||||  ||||||||||| | ||||||||||    
2668085 aacaacacttggccagtgcgcatgcctctacgcaagagctggattagtcgctcacctttagtgggttggaaatcagtgcgaaagc 2668169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 31 - 115
Target Start/End: Complemental strand, 34662404 - 34662320
Alignment:
31 ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaa 115  Q
    |||| |||| |||| ||||||||||||||||| |||||| ||| |||| |||| |||||||  ||| |||||||||| |||||||    
34662404 ggaataacgtttggtcagtacgcatgtctctatgcatgagccgaattagtcgtccacctttagtggattggaaaccgatgcgaaa 34662320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 21 - 117
Target Start/End: Complemental strand, 41630607 - 41630511
Alignment:
21 attcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||  |||||||||||||| ||||| |||||| |||||| ||||| |||||||| |||  |||||||| | ||| |||||| |||| ||||||    
41630607 attcccaaggggaacaacgcttgcccagtgcgcatgcctctacacatgagccggattagtcgcccacctttggttggtcggaaactggtgtgaaagc 41630511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #41
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 33 - 116
Target Start/End: Complemental strand, 37319972 - 37319889
Alignment:
33 aacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    ||||||||||| | |||  ||||| ||||||||| || | | ||||||||| |||| |||||||||||||||| ||||||||||    
37319972 aacaacgcttgacaagtgtgcatgcctctacgcacgagctgaattaatcgtccaccgttgatgggttggaaactggtgcgaaag 37319889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #42
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 19 - 78
Target Start/End: Original strand, 39849082 - 39849140
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggatta 78  Q
    ||||||||||||| |||||||||||||||||  ||||| |||||||||||| ||||||||    
39849082 cgattcccagagg-aacaacgcttggccagtgtgcatgcctctacgcatgagccggatta 39849140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #43
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 33 - 115
Target Start/End: Complemental strand, 2029350 - 2029268
Alignment:
33 aacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaa 115  Q
    ||||||||||||  |||||||||| |||||||||||| | |||||| |||  |||| ||||||||| | ||||| ||||||||    
2029350 aacaacgcttggttagtacgcatgcctctacgcatgagctggattagtcgcccaccattgatgggtcgcaaaccagtgcgaaa 2029268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #44
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 31 - 117
Target Start/End: Original strand, 15320208 - 15320294
Alignment:
31 ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||| | |||||||||  ||||| ||||||||| || |||||||| |||  |||||||| |||||  |||||||||||||||||    
15320208 ggaacaatgattggccagtgtgcatgcctctacgcacgagccggattagtcgcccacctttggtgggtcagaaaccggtgcgaaagc 15320294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #45
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 21 - 114
Target Start/End: Original strand, 8362589 - 8362682
Alignment:
21 attcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaa 114  Q
    |||||||| || ||||||| ||||||||| |||||| |||||||||||| ||  |||| |||| |||||||  ||| |  ||||||||||||||    
8362589 attcccagtggaaacaacgtttggccagtccgcatgcctctacgcatgagccaaattagtcgtccacctttagtggatccgaaaccggtgcgaa 8362682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #46
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 20 - 117
Target Start/End: Original strand, 13893937 - 13894034
Alignment:
20 gattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||| |||| ||||||||||||||| || | |||||| |||||| || || |||||||| |||  |||||||| ||| | | ||||||||||||||||    
13893937 gatttccagggggaacaacgcttggtcaatgcgcatgcctctacacacgagccggattagtcgcccacctttggtggatcgaaaaccggtgcgaaagc 13894034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #47
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 31 - 116
Target Start/End: Original strand, 19146983 - 19147068
Alignment:
31 ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    |||||||||||||||||||  | ||  ||||| ||| || | |||||| |||| |||||||| ||||| |||||||||||||||||    
19146983 ggaacaacgcttggccagtgtgtatccctctatgcacgagctggattagtcgtccacctttggtgggtcggaaaccggtgcgaaag 19147068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #48
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 30 - 111
Target Start/End: Original strand, 33688972 - 33689053
Alignment:
30 gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgc 111  Q
    ||||| ||| |||||||||| |||||| |||||||||||| || | ||| || | |||| ||| ||||||||||||||||||    
33688972 gggaataacacttggccagtgcgcatgcctctacgcatgagccagtttagtcatccaccattggtgggttggaaaccggtgc 33689053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #49
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 19 - 88
Target Start/End: Complemental strand, 42412871 - 42412802
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacc 88  Q
    |||||||| | |||||||||||||||| ||| | |||| |||||||||||| |||||||| ||| |||||    
42412871 cgattcccggggggaacaacgcttggcaagtgcccatgcctctacgcatgagccggattagtcgctcacc 42412802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #50
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 33 - 117
Target Start/End: Complemental strand, 24506731 - 24506647
Alignment:
33 aacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||||||| ||||| | |||| ||||||||||||  | ||||| ||| ||||| ||| ||||| |||||||||||| |||||    
24506731 aacaacgcttgaccagtgcacatgcctctacgcatgagtcagattagtcgctcaccattggtgggtcggaaaccggtgcaaaagc 24506647  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #51
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 53 - 117
Target Start/End: Complemental strand, 29195382 - 29195318
Alignment:
53 catgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||| |||||| |||||||| ||||| |||| |||||||  |||||||||||||||| |||||||    
29195382 catgcctctacacatgaaccagattagtcgtccacctttagtgggttggaaaccggtacgaaagc 29195318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #52
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 50405700 - 50405608
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgc 111  Q
    ||||||| || || ||||||||||| ||||| |||||| ||||||||| ||  ||||||| |||  |||| ||| ||||| ||||||||||||    
50405700 cgattccgaggggaaacaacgcttgaccagtgcgcatgcctctacgcacgagtcggattagtcgcccaccattggtgggtcggaaaccggtgc 50405608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #53
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 115
Target Start/End: Complemental strand, 51683051 - 51682955
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaa 115  Q
    |||||||||| |||||||||||||| ||||| |||||| |||| | || || |||||||| |||  ||||  || ||||| ||||||| ||||||||    
51683051 cgattcccagggggaacaacgcttgaccagtgcgcatgcctctccacacgagccggattagtcgcccaccaatggtgggtcggaaaccagtgcgaaa 51682955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #54
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 31 - 94
Target Start/End: Original strand, 3763072 - 3763135
Alignment:
31 ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgat 94  Q
    |||||||||||||| ||||  ||||||||||||||| |||| |||||| |||| |||| |||||    
3763072 ggaacaacgcttggtcagtgtgcatgtctctacgcacgaactggattagtcgtccaccattgat 3763135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #55
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 19 - 114
Target Start/End: Original strand, 4638164 - 4638259
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaa 114  Q
    ||||||||||  | ||||||||||| ||||| |||||  ||||||||| || |||||||| | |  ||||||| |||||| |||||||| ||||||    
4638164 cgattcccaggagaaacaacgcttgaccagtgcgcatacctctacgcacgagccggattagtagcccacctttaatgggtcggaaaccgatgcgaa 4638259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #56
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 19 - 78
Target Start/End: Complemental strand, 26207898 - 26207839
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggatta 78  Q
    |||||||||  |||||||||||||| |||||  ||||| |||||||||||| ||||||||    
26207898 cgattcccacggggaacaacgcttgtccagtgtgcatgcctctacgcatgagccggatta 26207839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #57
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 19 - 98
Target Start/End: Original strand, 40944893 - 40944971
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggt 98  Q
    |||||||||| ||||||||| |||  |||||| ||||| ||||||||||| | ||||||| ||| ||||||||| |||||    
40944893 cgattcccagggggaacaacacttaaccagtatgcatgcctctacgcatg-agcggattagtcgctcacctttggtgggt 40944971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #58
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 928610 - 928708
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||| ||| ||||||||| |||| ||||| |||||| | ||||||| || |||||||| || | |||||||| || || | ||| ||||||||||||    
928610 cgattctcagggggaacaacacttgaccagtgcgcatgccgctacgcacgagccggattagtcatccacctttggtgagtcgaaaatcggtgcgaaagc 928708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #59
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 13367445 - 13367531
Alignment:
30 gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    ||||||||||||||| ||||  ||||| || ||||||||| |||||||| ||    ||| ||| ||||| |||||||||||||||||    
13367445 gggaacaacgcttggtcagtgtgcatgcctttacgcatgagccggattagtcacctaccgttgttgggtaggaaaccggtgcgaaag 13367531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #60
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 71 - 117
Target Start/End: Original strand, 21325126 - 21325172
Alignment:
71 ccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||||||||  || ||||||||||| ||||||||||||||||||    
21325126 ccggattaatcgcccatctttgatgggtcggaaaccggtgcgaaagc 21325172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #61
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 60 - 117
Target Start/End: Complemental strand, 36043730 - 36043673
Alignment:
60 ctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||| || |||||||| |||  |||||||| ||||| ||||||||||||||||||    
36043730 ctacgcacgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc 36043673  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #62
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 53 - 117
Target Start/End: Original strand, 10043726 - 10043790
Alignment:
53 catgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||| ||||||||| ||  | ||||||||| ||||| ||| ||||| ||||||||||||||||||    
10043726 catgcctctacgcacgaggcagattaatcgctcaccattggtgggtcggaaaccggtgcgaaagc 10043790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #63
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 33 - 117
Target Start/End: Complemental strand, 35998654 - 35998570
Alignment:
33 aacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||||  |||| | |||| ||||||||| ||   ||||||||||| |||||||  |||||  |||||||||||||||||    
35998654 aacaacgcttgatcagtgcacatgcctctacgcacgagttggattaatcgtccacctttagtgggtcagaaaccggtgcgaaagc 35998570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 57; Significance: 7e-24; HSPs: 37)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 19 - 115
Target Start/End: Complemental strand, 4479391 - 4479296
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaa 115  Q
    |||||||||| |||||||||||||||||||| |||||| |||||||||||| | |||||| |||| |||||||| ||||| ||||||||||||||||    
4479391 cgattcccag-gggaacaacgcttggccagtgcgcatgcctctacgcatgagctggattagtcgtccacctttggtgggtcggaaaccggtgcgaaa 4479296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 31 - 117
Target Start/End: Original strand, 10927632 - 10927718
Alignment:
31 ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||||||||||||||| |||||| |||||||||||| |||||||| ||||||||||||  ||||| |||||||| |||||||||    
10927632 ggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgttcacctttagtgggtcggaaaccgatgcgaaagc 10927718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 45521183 - 45521280
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||| ||||||||| ||||  |||| |||||| |||||||||||| |||||||| ||| ||||||||||||||| ||||||||||||||||||    
45521183 cgattcccag-gggaacaacacttgatcagtgcgcatgcctctacgcatgagccggattagtcgctcacctttgatgggtcggaaaccggtgcgaaagc 45521280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 19 - 91
Target Start/End: Complemental strand, 1013073 - 1013001
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcaccttt 91  Q
    |||||||||| |||||||||||||||||||||| |||| |||||||||||| ||| |||||||||||||||||    
1013073 cgattcccagggggaacaacgcttggccagtacacatgcctctacgcatgagccgaattaatcgttcaccttt 1013001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 6100486 - 6100584
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||||||  ||||||||||||||||||| |||||| | |||||||||| |||||||| ||||||||||||  ||||| | |||||| |||||||||    
6100486 cgattcccaggaggaacaacgcttggccagtgcgcatgccactacgcatgagccggattagtcgttcacctttagtgggtcgaaaaccgctgcgaaagc 6100584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 43032915 - 43033013
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||| |||||||||||||||||||| |||||| |||||| || || |||||||| |||  |||||||| |||||  |||||||||||||||||    
43032915 cgattcccagggggaacaacgcttggccagtgcgcatgcctctacacacgagccggattagtcgcccacctttggtgggtcagaaaccggtgcgaaagc 43033013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 31 - 116
Target Start/End: Complemental strand, 68182 - 68097
Alignment:
31 ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    ||||||||| |||||||||| ||||| || ||| || || |||||||||||||||||||||||||||| |||||||||||| ||||    
68182 ggaacaacgtttggccagtatgcatgcctttacacacgagccggattaatcgttcacctttgatgggtcggaaaccggtgcaaaag 68097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 29 - 117
Target Start/End: Original strand, 583836 - 583924
Alignment:
29 agggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||||||||||| ||||| |||||| ||||||||||||  ||||||| |||  |||||||||||| || |||||||||||||||||    
583836 agggaacaacgcttgaccagtgcgcatgcctctacgcatgagtcggattagtcgcccacctttgatggattagaaaccggtgcgaaagc 583924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 26 - 117
Target Start/End: Complemental strand, 11298356 - 11298265
Alignment:
26 cagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||||||||| ||| |||||| |||||| ||||| |||||| ||  |||||||| ||||||||| ||||| ||||||||||||||||||    
11298356 cagagggaacaacacttagccagtgcgcatgcctctatgcatgagccaaattaatcgctcacctttggtgggtcggaaaccggtgcgaaagc 11298265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 2467214 - 2467116
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||| |||| ||||||||| |||||||||| |||||||||||| |||||| |||||||| |||| |||  ||| || || ||||||||||||||||||    
2467214 cgatttccagggggaacaactcttggccagtgcgcatgtctctatgcatgagccggattagtcgtccacaattggtgtgtcggaaaccggtgcgaaagc 2467116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 43027319 - 43027417
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||||||  ||||||||| ||| ||| | |||||| |||||||||||| |||||||| |||| || ||||||||||| |||||||| |||||||||    
43027319 cgattcccaggaggaacaacgattgtccaatgcgcatgcctctacgcatgagccggattagtcgtccatctttgatgggtcggaaaccgatgcgaaagc 43027417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 44893363 - 44893277
Alignment:
30 gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    |||||||| |||||||||||  ||||| ||||||||| || |||||||||||| ||||| ||||||||| |||||||||||| ||||    
44893363 gggaacaatgcttggccagtgtgcatgcctctacgcacgagccggattaatcgctcacccttgatgggtcggaaaccggtgcaaaag 44893277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 19 - 115
Target Start/End: Complemental strand, 15884651 - 15884556
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaa 115  Q
    |||||||||| ||||||||| |||||| ||| |||||| ||||||||| || |||||||| |||  |||||||| ||||| ||||||||||||||||    
15884651 cgattcccag-gggaacaacacttggcaagtgcgcatgcctctacgcacgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaa 15884556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 32 - 116
Target Start/End: Original strand, 23895595 - 23895679
Alignment:
32 gaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    |||||||||||||||||| |||||  ||||||||| ||   ||||||||||| |||||||||||||| |||||| ||||||||||    
23895595 gaacaacgcttggccagtgcgcatacctctacgcacgagatggattaatcgtccacctttgatgggtcggaaacgggtgcgaaag 23895679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 30 - 117
Target Start/End: Complemental strand, 8997629 - 8997542
Alignment:
30 gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||| || |||||| |||||| || ||||||||| || ||||| ||||||| ||||| ||||| ||||||||||||||||||    
8997629 gggaacaacgtttcgccagttcgcatgcctatacgcatgagccagattagtcgttcatctttggtgggtcggaaaccggtgcgaaagc 8997542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 31 - 117
Target Start/End: Original strand, 2964102 - 2964188
Alignment:
31 ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||||||||||||| |  ||||| ||||||||| ||||||||||| |||  |||||||| |||||  |||||||||||||||||    
2964102 ggaacaacgcttggccaatgtgcatgcctctacgcacgaaccggattagtcgcccacctttggtgggtcagaaaccggtgcgaaagc 2964188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 19 - 116
Target Start/End: Original strand, 18374024 - 18374121
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    |||||| ||| | |||||||||||| ||||| |||||| |||||||||||| |||||||| |||| || ||||| ||||| | |||||||||| ||||    
18374024 cgattctcagggagaacaacgcttgaccagtgcgcatgcctctacgcatgagccggattagtcgtccaactttggtgggtcgaaaaccggtgcaaaag 18374121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 21 - 117
Target Start/End: Original strand, 26570940 - 26571036
Alignment:
21 attcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||| || ||||||||||||||||||||  | |||  ||||||||||| |||||||| |||| ||||||||||| || |||||||| || ||||||    
26570940 attcctagggggaacaacgcttggccagtgtgtatgcatctacgcatgagccggattagtcgtccacctttgatgagtcggaaaccgatgtgaaagc 26571036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 30 - 117
Target Start/End: Complemental strand, 10535489 - 10535402
Alignment:
30 gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||| |||||| ||||| |||||||||| |||||||| ||| |||| ||||||||||||| |  || |||||| |||||||||||    
10535489 gggaacaccgcttgaccagtgcgcatgtctccacgcatgagccgaattagtcgttcacctttggtaagtcggaaactggtgcgaaagc 10535402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 30 - 117
Target Start/End: Complemental strand, 16291288 - 16291201
Alignment:
30 gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||||| |||||||||||| |||| ||||| |||||| | |||||| ||| ||||||||| ||||| | ||||||||| ||||||    
16291288 gggaacaacacttggccagtacacatgcctctatgcatgagctggattagtcgctcacctttggtgggtcgaaaaccggtgtgaaagc 16291201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 8141116 - 8141214
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||| |||| || ||||||||||||||||| |||||| |||||||||||| | | |||| |||| ||| |||| |||||  ||||||| |||||||||    
8141116 cgatttccaggggaaacaacgcttggccagtgcgcatgcctctacgcatgagctgaattagtcgtccacatttggtgggtcagaaaccgatgcgaaagc 8141214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 33 - 109
Target Start/End: Complemental strand, 24938644 - 24938568
Alignment:
33 aacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggt 109  Q
    |||||| ||||| || | |||||| ||||||||||||||||||||| || | |||||||||||| | ||||||||||    
24938644 aacaacacttggtcaatgcgcatgcctctacgcatgaaccggattagtcatccacctttgatggatcggaaaccggt 24938568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 21 - 76
Target Start/End: Complemental strand, 8587033 - 8586978
Alignment:
21 attcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggat 76  Q
    |||||||| |||||||||||||||||||| |||||  |||||||||||| ||||||    
8587033 attcccagggggaacaacgcttggccagtgcgcatacctctacgcatgagccggat 8586978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 19 - 66
Target Start/End: Complemental strand, 38922510 - 38922463
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgca 66  Q
    ||||||||||||||||||||||||||||||| |||||| || ||||||    
38922510 cgattcccagagggaacaacgcttggccagtgcgcatgcctttacgca 38922463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 31 - 117
Target Start/End: Complemental strand, 3418597 - 3418511
Alignment:
31 ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||| |||||||||| ||||||  |||||||||||  | ||||| |||| |||||||  |||||  |||||||||||||||||    
3418597 ggaacaacacttggccagtgcgcatgcgtctacgcatgagtcagattagtcgtccacctttagtgggtcagaaaccggtgcgaaagc 3418511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 16893951 - 16894047
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||| ||| ||||| |||||||||||||||| |||| || ||||||||| |||||||  |||  |||||||| | ||| ||||||||||||||||||    
16893951 cgattcacagggggaataacgcttggccagtacacatgcctttacgcatgagccggatt-gtcgcccacctttggt-ggtcggaaaccggtgcgaaagc 16894047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 26 - 92
Target Start/End: Original strand, 22958791 - 22958857
Alignment:
26 cagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttg 92  Q
    |||||||||||| |||||| ||||  ||||||||||| |||||| |||||||| |||| ||||||||    
22958791 cagagggaacaatgcttggtcagtgtgcatgtctctatgcatgagccggattagtcgtccacctttg 22958857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 24837256 - 24837354
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||| | ||||||||||||||||||   |||| ||||| ||| || | |||||| |||| |||||||| ||| | |||||| |||||||||||    
24837256 cgattcccagggagaacaacgcttggccagtgttcatgcctctaagcacgagcaggattagtcgtccacctttggtggatcggaaactggtgcgaaagc 24837354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #29
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 36662429 - 36662515
Alignment:
30 gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    ||||||||  ||| |||||| |||||| ||||||| ||||||||||||| |||| ||| ||| |||| | |||||||| ||||||||    
36662429 gggaacaatacttagccagtgcgcatgcctctacgtatgaaccggattagtcgtccacttttaatggatcggaaaccgatgcgaaag 36662515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #30
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 36 - 117
Target Start/End: Original strand, 3692864 - 3692945
Alignment:
36 aacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||| |||| |||| |||||  |||||||||||| ||| |||||||||||||||||| | ||| | |||||||| |||||||    
3692864 aacgtttggtcagtgcgcatacctctacgcatgagccgaattaatcgttcacctttggtaggtcgaaaaccggtacgaaagc 3692945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #31
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 30 - 111
Target Start/End: Original strand, 11785940 - 11786021
Alignment:
30 gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgc 111  Q
    |||| ||||| |||| ||||  ||||| |||||||||||| || ||||||||| ||| ||||||||| | ||||||||||||    
11785940 gggagcaacgtttgggcagtgtgcatgcctctacgcatgagccagattaatcgctcatctttgatggatcggaaaccggtgc 11786021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #32
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 19 - 78
Target Start/End: Original strand, 6042835 - 6042894
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggatta 78  Q
    |||||||||  |||||||||||||||||||| |||||| ||  |||||||| ||||||||    
6042835 cgattcccaaggggaacaacgcttggccagtgcgcatgcctaaacgcatgagccggatta 6042894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #33
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 30 - 117
Target Start/End: Original strand, 14846600 - 14846687
Alignment:
30 gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||| | |||| |||| |||||| ||||||||||||  | ||| | |||| |||||||| ||||| ||||| ||||||||||||    
14846600 gggaacaatgattggtcagtgcgcatgcctctacgcatgagtcagataagtcgtccacctttggtgggtcggaaatcggtgcgaaagc 14846687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #34
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 31 - 117
Target Start/End: Complemental strand, 22212600 - 22212513
Alignment:
31 ggaacaacgcttgg-ccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||||| | ||||||||||||  |||||||| |  |||||||| ||| ||||||||| ||| | | ||||||||||||||||    
22212600 ggaacaacgctttgaccagtacgcatgcttctacgcacgggccggattagtcgctcacctttggtggttcgaaaaccggtgcgaaagc 22212513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #35
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 14666167 - 14666069
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||| || |||||| |||||||||| |||||| |||||||||  | || ||||| |||  |||  ||| ||||| | ||||||||||||||||    
14666167 cgattcccaggggaaacaacacttggccagtgcgcatgcctctacgcacaagccagattagtcgcccacagttggtgggtcgaaaaccggtgcgaaagc 14666069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #36
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 27975905 - 27976003
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||||||| |||||||| ||||  ||||  ||||| |||||||| ||| ||||||||||||  |||||||  |||||  | ||||| |||||||||    
27975905 cgattcccagaaggaacaacacttgatcagtgtgcatgcctctacgcttgagccggattaatcgcccacctttagtgggtcaggaaccgatgcgaaagc 27976003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #37
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 28033174 - 28033272
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||||||| |||||||| ||||  ||||  ||||| |||||||| ||| ||||||||||||  |||||||  |||||  | ||||| |||||||||    
28033174 cgattcccagaaggaacaacacttgatcagtgtgcatgcctctacgcttgagccggattaatcgcccacctttagtgggtcaggaaccgatgcgaaagc 28033272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0016 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: scaffold0016
Description:

Target: scaffold0016; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 8797 - 8699
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||| |||||||||||||||||||| ||| || |||||||||||| | |||||| |||| |||||||| ||||| |||||| |||||||||||    
8797 cgattcccagggggaacaacgcttggccagtgcgcttgcctctacgcatgagctggattagtcgtccacctttggtgggtcggaaactggtgcgaaagc 8699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 55; Significance: 1e-22; HSPs: 57)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 5855533 - 5855631
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||||||  ||||||||||||||||||| |||||| ||||||||||||  ||||||| ||||||||||||  ||||| |||||||| |||||||||    
5855533 cgattcccaggaggaacaacgcttggccagtgcgcatgcctctacgcatgaggcggattagtcgttcacctttagtgggtcggaaaccgatgcgaaagc 5855631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 17642101 - 17642003
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||| ||||||||| |||||||||| |||||| ||||||||| || |||||||| |||| |||||||| ||||| |||||| |||||||||||    
17642101 cgattcccagggggaacaacacttggccagtgcgcatgcctctacgcacgagccggattagtcgtccacctttggtgggtcggaaactggtgcgaaagc 17642003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 18915878 - 18915976
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||| ||||||||| ||||||||||  ||||| ||||||||| || |||||||| ||| ||||| ||| ||||||||||||||||||||||||    
18915878 cgattcccagggggaacaacacttggccagtgtgcatgcctctacgcacgagccggattagtcgctcaccattggtgggttggaaaccggtgcgaaagc 18915976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 26325823 - 26325921
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||| ||||||||| ||||| |||| |||||| |||||||||||| |||||||| |||| |||| ||| ||||| ||||||||||||||||||    
26325823 cgattcccagcgggaacaacacttggtcagtgcgcatgcctctacgcatgagccggattagtcgtccaccattggtgggtcggaaaccggtgcgaaagc 26325921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 49078125 - 49078223
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||| || |||||| |||||||||| |||||| |||||||||||| |||||||| ||||||||| ||| | ||| ||||||||||||||||||    
49078125 cgattcccaggggaaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgttcaccattggtaggtcggaaaccggtgcgaaagc 49078223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 30 - 106
Target Start/End: Complemental strand, 14254354 - 14254278
Alignment:
30 gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaacc 106  Q
    ||||||||||||||||||||||||||| || ||||||||| |||||||| |||| |||||||||||||| |||||||    
14254354 gggaacaacgcttggccagtacgcatgcctttacgcatgagccggattagtcgtccacctttgatgggtcggaaacc 14254278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 22 - 117
Target Start/End: Original strand, 8764005 - 8764100
Alignment:
22 ttcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||| ||||||||| |||||||||| |||||| ||||||||| || |||||||| |||| |||| ||| ||||| ||||||||||||||||||    
8764005 ttcccagggggaacaacacttggccagtgcgcatgcctctacgcacgagccggattagtcgtccaccgttggtgggtcggaaaccggtgcgaaagc 8764100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 33 - 116
Target Start/End: Original strand, 14357780 - 14357863
Alignment:
33 aacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    ||||||| ||| ||||| |||||| ||||||||| ||||||||||||||||| ||| ||||||||| |||||||||||||||||    
14357780 aacaacgtttgaccagtgcgcatgcctctacgcacgaaccggattaatcgtttaccattgatgggtcggaaaccggtgcgaaag 14357863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 9659275 - 9659178
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||| |||||||||| ||| | ||| |||||| || ||||||||| |||||||| |||| |||||||| ||||||||||||||||||||||||    
9659275 cgattcccag-gggaacaacgtttgactagtgcgcatgcctttacgcatgagccggattagtcgtccacctttggtgggttggaaaccggtgcgaaagc 9659178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 41663953 - 41663855
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||| ||||||||| ||||| |||| |||||| |||||||||||| | |||||| |||| |||| ||| ||||| ||||||||||||||||||    
41663953 cgattcccagggggaacaacacttggtcagtgcgcatgcctctacgcatgagctggattagtcgtccaccattggtgggtcggaaaccggtgcgaaagc 41663855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 31 - 117
Target Start/End: Complemental strand, 45361967 - 45361881
Alignment:
31 ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||||||||||||||| |||||| | |||||||| | |||||||| ||||||||||||  ||||| ||||||||||||||||||    
45361967 ggaacaacgcttggccagtgcgcatgccactacgcataagccggattagtcgttcacctttagtgggtcggaaaccggtgcgaaagc 45361881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 32 - 117
Target Start/End: Complemental strand, 10173055 - 10172970
Alignment:
32 gaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||||||||||| | |||| |||||||||||| |||||||| |||  |||||||| ||||| ||||||||||||||||||    
10173055 gaacaacgcttggccagtgcccatgcctctacgcatgagccggattactcgcccacctttggtgggtcggaaaccggtgcgaaagc 10172970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 21 - 117
Target Start/End: Complemental strand, 43959916 - 43959820
Alignment:
21 attcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||| |||||||||||||||||||| |||||| ||||||||| || |||||||| |||  |||||||  ||| | ||||||||||||||||||    
43959916 attcccagggggaacaacgcttggccagtgcgcatgcctctacgcacgagccggattagtcgcccacctttagtggatcggaaaccggtgcgaaagc 43959820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 30 - 117
Target Start/End: Complemental strand, 32142932 - 32142845
Alignment:
30 gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||||| |||||||||| |||||| || ||||||||| ||| |||| ||| ||||||||||||||| |||||||| |||||||||    
32142932 gggaacaacacttggccagtgcgcatgcctttacgcatgagccgaattagtcgctcacctttgatgggtcggaaaccgatgcgaaagc 32142845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 34 - 117
Target Start/End: Original strand, 37339846 - 37339929
Alignment:
34 acaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||||||||| |||||| ||| ||||| || |||||||| |||  |||||||| ||||||||||||||||||||||||    
37339846 acaacgcttggccagtgcgcatgcctcaacgcacgagccggattagtcgcccacctttggtgggttggaaaccggtgcgaaagc 37339929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 30 - 96
Target Start/End: Original strand, 10336538 - 10336604
Alignment:
30 gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgg 96  Q
    |||||||||||||| ||||| |||||| |||||||||||| ||||||||||||| ||||||||||||    
10336538 gggaacaacgcttgaccagtgcgcatgcctctacgcatgagccggattaatcgtccacctttgatgg 10336604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 31 - 117
Target Start/End: Original strand, 10422811 - 10422897
Alignment:
31 ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||| |||||||||| |||||| |||||||||||| |||||||| |||| |||||||| |  || ||||||||||||||||||    
10422811 ggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgtccacctttggtaagtcggaaaccggtgcgaaagc 10422897  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 30927824 - 30927726
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||| ||||||||||||||||||||||| |  ||||| |||||||||||| |||||||| |||| ||| |||| |||||  ||||||||||| |||||    
30927824 cgatttccagagggaacaacgcttggccaatgtgcatgcctctacgcatgagccggattagtcgtccacttttggtgggtcagaaaccggtgcaaaagc 30927726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 31 - 116
Target Start/End: Original strand, 16263568 - 16263653
Alignment:
31 ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    ||||||||||||||||||| |||||| |||||||||| | ||||| || |||| ||| |||||||| | |||||||||||||||||    
16263568 ggaacaacgcttggccagtgcgcatgcctctacgcataagccggaatagtcgtccacttttgatggatcggaaaccggtgcgaaag 16263653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 30 - 117
Target Start/End: Original strand, 34697357 - 34697444
Alignment:
30 gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||||| |||||| |||  ||||| |||||||||||| |||||||| |||  ||| ||||||||||||||||||| |||||||||    
34697357 gggaacaacacttggctagtgtgcatgcctctacgcatgagccggattagtcgcccacttttgatgggttggaaaccgatgcgaaagc 34697444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 15238203 - 15238105
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||| |||| ||||||||||||| |  ||||| ||||||||| ||| |  |||| ||| ||||||||| |||||||||||||||| |||||||    
15238203 cgattcccagggggagcaacgcttggccaatgagcatgcctctacgcacgaatcatattagtcgctcacctttggtgggttggaaaccggttcgaaagc 15238105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 35 - 117
Target Start/End: Complemental strand, 33498920 - 33498838
Alignment:
35 caacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||||||||||| |||||| |||||||||||| |||||||| |||| |||||||||||| | | ||| |||| |||||||    
33498920 caacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgtccacctttgatggatcgtaaagcggtacgaaagc 33498838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 35211269 - 35211171
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||| ||||| ||||||| |||| |||| |||||||| |||||||||||| | | |||| |||| |||||||| ||||| ||||||||||| ||||||    
35211269 cgatttccagaaggaacaatgcttagccaatacgcatgcctctacgcatgagctgaattagtcgtccacctttggtgggtcggaaaccggtgtgaaagc 35211171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 40 - 117
Target Start/End: Complemental strand, 4581758 - 4581681
Alignment:
40 cttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||| |||||| ||||||||| || ||||| || |||| |||||||| ||||| ||||||||||||||||||    
4581758 cttggccagtgcgcatgcctctacgcacgagccggaatagtcgtccacctttggtgggtcggaaaccggtgcgaaagc 4581681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 33 - 116
Target Start/End: Original strand, 5504056 - 5504139
Alignment:
33 aacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    |||||||||||   ||| | |||| |||||||||||| |||||||| |||| |||||||||||||| |||||||||| ||||||    
5504056 aacaacgcttgattagtgcacatgcctctacgcatgagccggattagtcgtccacctttgatgggtcggaaaccggtacgaaag 5504139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 30 - 117
Target Start/End: Complemental strand, 11397975 - 11397888
Alignment:
30 gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||| ||||||| | || ||| ||||||||||||  ||||||| |||| |||||||| ||||| ||||| ||||||||||||    
11397975 gggaacaacgtttggccaatgcgtatgcctctacgcatgagtcggattagtcgtccacctttggtgggtcggaaatcggtgcgaaagc 11397888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 46 - 117
Target Start/End: Original strand, 26660176 - 26660246
Alignment:
46 cagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||||||| |||||||||||| |||||||| |||  |||||||| ||||| ||||||||||||||||||    
26660176 cagtacgcatgcctctacgcatgagccggattagtcg-ccacctttggtgggtcggaaaccggtgcgaaagc 26660246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 41 - 116
Target Start/End: Complemental strand, 45726508 - 45726433
Alignment:
41 ttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    ||||||||| || |||||||||||||||| |||||||| ||||||||||||| ||| | ||| || ||||||||||    
45726508 ttggccagtgcgtatgtctctacgcatgagccggattagtcgttcacctttggtggatcggagactggtgcgaaag 45726433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 20 - 117
Target Start/End: Complemental strand, 12036840 - 12036742
Alignment:
20 gattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttgg-aaaccggtgcgaaagc 117  Q
    |||||| || |||||||| ||||||||||| |||||| ||||||||| || || |||||||||| |||||||| ||| | || ||||| ||||||||||    
12036840 gattcctagggggaacaatgcttggccagtgcgcatgcctctacgcacgagccagattaatcgtccacctttggtggatcggaaaaccagtgcgaaagc 12036742  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 18649438 - 18649352
Alignment:
30 gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    |||||||||||||| ||||| |||||| ||||||| | || || |||||||||  |||||||  ||| |||||||||||||||||||    
18649438 gggaacaacgcttgaccagtgcgcatgcctctacgtacgagccagattaatcgcccacctttagtggattggaaaccggtgcgaaag 18649352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 32151019 - 32150921
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||| |||| |||||||||  |||| |||| |||||| || ||||||||| ||| |||| ||| ||||||||||||||| | |||||| |||||||||    
32151019 cgatttccagggggaacaacatttggtcagtgcgcatgcctttacgcatgagccgaattagtcgctcacctttgatgggtcgaaaaccgatgcgaaagc 32150921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 34719787 - 34719885
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||  ||||| |||||||| ||||| |||||| ||||||||| ||  | ||||| ||| ||||||||| ||||| |||||| |||||||||||    
34719787 cgattcccactgggaataacgcttgaccagtgcgcatgcctctacgcacgagtcagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc 34719885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 116
Target Start/End: Complemental strand, 21849301 - 21849205
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    |||||||||| |||||||||||||||| ||| |||||| ||||||||| || |||||||| ||| ||||  ||| ||||| | |||||||| ||||||    
21849301 cgattcccag-gggaacaacgcttggctagtgcgcatgcctctacgcacgagccggattagtcgctcactattggtgggtcgaaaaccggtacgaaag 21849205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #34
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 32 - 116
Target Start/End: Complemental strand, 50371918 - 50371834
Alignment:
32 gaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    |||||||||||||||||||||||||  ||||||||  | |||||||| |||  || ||||| ||| | |||||||||||||||||    
50371918 gaacaacgcttggccagtacgcatgcttctacgcacaagccggattagtcgcccatctttggtggatcggaaaccggtgcgaaag 50371834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #35
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 30 - 117
Target Start/End: Complemental strand, 5143239 - 5143153
Alignment:
30 gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||||||||||| ||||||||||| |||||||||  |  ||||||| ||| ||||||||||||| | | ||||||||| ||||||    
5143239 gggaacaacgcttggtcagtacgcatgcctctacgca-cagacggattagtcgctcacctttgatggatcgaaaaccggtgtgaaagc 5143153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #36
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 33 - 116
Target Start/End: Original strand, 19195391 - 19195469
Alignment:
33 aacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    ||||||| ||||||||| |||||| |||||||||||| |||     ||||| ||||||||||| || |||||||||||||||||    
19195391 aacaacgtttggccagtgcgcatgcctctacgcatgagccg-----atcgtccacctttgatgagtcggaaaccggtgcgaaag 19195469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #37
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 19 - 106
Target Start/End: Complemental strand, 33418212 - 33418125
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaacc 106  Q
    ||||||| || ||| |||||||||||||||| |||||| ||||| ||| || |||||||| |||| |||||||| | ||| |||||||    
33418212 cgattcctaggggggacaacgcttggccagtgcgcatgcctctatgcacgagccggattagtcgtccacctttggtcggtcggaaacc 33418125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #38
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 30 - 117
Target Start/End: Original strand, 50094926 - 50095013
Alignment:
30 gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||| ||| ||||||||||||  |||||||||||  ||||||| |||| |||| ||  ||||| |||||||||||| |||||    
50094926 gggaacaacgtttgaccagtacgcatgcttctacgcatgagtcggattagtcgtccaccattagtgggtcggaaaccggtgcaaaagc 50095013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #39
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 32882 - 32980
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||||||  |||||||||||||| |||| | |||| |||||||||||| ||| |||| ||||  || |||||||| | |||||||| | |||||||    
32882 cgattcccaggaggaacaacgcttggtcagtgcacatgcctctacgcatgagccgaattagtcgtctacttttgatggatcggaaaccgatacgaaagc 32980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #40
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 2981028 - 2980930
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||| ||||||||| ||||||||||  ||||| ||||||||| ||  ||||||| |||| ||  |||  ||||| ||||| ||||||||||||    
2981028 cgattcccagcgggaacaacacttggccagtgtgcatgcctctacgcacgagtcggattagtcgtccatgtttagtgggtcggaaatcggtgcgaaagc 2980930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #41
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 39 - 117
Target Start/End: Complemental strand, 18708617 - 18708539
Alignment:
39 gcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||| ||| |||||| |||||| ||||| || ||||| ||| ||||||||||||||||| |||||| ||| |||||    
18708617 gcttggctagtgcgcatgcctctacacatgagccagattagtcgctcacctttgatgggttgaaaaccgatgctaaagc 18708539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #42
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 34 - 116
Target Start/End: Original strand, 26258721 - 26258803
Alignment:
34 acaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    ||||||||||| |||| | |||| || |||||||||  |||||||||||| |||||||  |||||||||||| ||||| ||||    
26258721 acaacgcttggtcagtgcacatgcctttacgcatgagtcggattaatcgtccacctttagtgggttggaaactggtgcaaaag 26258803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #43
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 32 - 117
Target Start/End: Original strand, 44969688 - 44969773
Alignment:
32 gaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||||||||||||||  ||||| | |||||||||| |||||||| |||| || | ||| ||| | ||||||||||| ||||||    
44969688 gaacaacgcttggccagtgtgcatgcccctacgcatgagccggattagtcgtccatcattggtggatcggaaaccggtgtgaaagc 44969773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #44
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 32 - 117
Target Start/End: Complemental strand, 46929822 - 46929737
Alignment:
32 gaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||||||||| | |||||| ||| || ||||| |||||||| |||| ||| |||||||| | | |||||| |||||||||    
46929822 gaacaacgcttggccaatgcgcatgcctccacacatgagccggattagtcgtccacttttgatggatcgaaaaccgatgcgaaagc 46929737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #45
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 21 - 117
Target Start/End: Original strand, 18808278 - 18808374
Alignment:
21 attcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||| |||||||||||||||||| ||||| |||||| || || | |||| |||||||| |||   | ||||  ||||| ||||||||||||||||||    
18808278 attctcagagggaacaacgcttgaccagtgcgcatgcctttatgtatgagccggattattcgactaactttattgggtcggaaaccggtgcgaaagc 18808374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #46
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 19 - 66
Target Start/End: Original strand, 6563452 - 6563499
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgca 66  Q
    ||||||| || |||||||||||||||||||| | ||||||||||||||    
6563452 cgattcctagggggaacaacgcttggccagtgcacatgtctctacgca 6563499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #47
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 30 - 117
Target Start/End: Complemental strand, 12744609 - 12744522
Alignment:
30 gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||||||| | ||| ||||||||||||||||||| ||| |||| ||| ||||  ||| |||||  ||||| | |||||||||    
12744609 gggaacaacgcttgactagtgcgcatgtctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagatgcgaaagc 12744522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #48
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 30 - 117
Target Start/End: Complemental strand, 12755599 - 12755512
Alignment:
30 gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||||||| | ||| ||||||||||||||||||| ||| |||| ||| ||||  ||| |||||  ||||| | |||||||||    
12755599 gggaacaacgcttgactagtgcgcatgtctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagatgcgaaagc 12755512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #49
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 19 - 78
Target Start/End: Complemental strand, 48798167 - 48798108
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggatta 78  Q
    ||||| |||| |||||||||||||| | ||| |||||| |||||||||||| ||||||||    
48798167 cgatttccagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccggatta 48798108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #50
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 15465976 - 15466074
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||| |||| ||||||||||||||| |||| | |||| ||||||||| ||  | ||||  ||| ||||||||| ||||| |||||||| | |||||||    
15465976 cgatttccagggggaacaacgcttggtcagtgcacatgcctctacgcacgagtctgattggtcgctcacctttggtgggtcggaaaccgatacgaaagc 15466074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #51
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 33 - 83
Target Start/End: Complemental strand, 17988743 - 17988693
Alignment:
33 aacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgt 83  Q
    ||||| ||||||||||| |||||  ||||||||||||||||||||| ||||    
17988743 aacaatgcttggccagtgcgcatacctctacgcatgaaccggattagtcgt 17988693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #52
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 63 - 117
Target Start/End: Original strand, 51437512 - 51437566
Alignment:
63 cgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||| |||||||| || | |||||||| ||||| ||||||||||||||||||    
51437512 cgcatgagccggattagtcatccacctttggtgggtcggaaaccggtgcgaaagc 51437566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #53
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 63 - 116
Target Start/End: Complemental strand, 8905216 - 8905163
Alignment:
63 cgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    ||||||| || |||||||||  |||||||||| ||| |||||||||||||||||    
8905216 cgcatgagccagattaatcgaccacctttgattggtcggaaaccggtgcgaaag 8905163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #54
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 20 - 117
Target Start/End: Original strand, 28416958 - 28417055
Alignment:
20 gattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||| |||||||||||||| ||||||||  ||||||  |||||||| ||||| ||||| | | ||||  ||||||| | | ||||||||| ||||||    
28416958 gattctcagagggaacaacgtttggccagggcgcatgcatctacgcacgaacccgattagttgctcactattgatggatcgaaaaccggtgtgaaagc 28417055  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #55
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 19 - 116
Target Start/End: Complemental strand, 31576644 - 31576547
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    |||||| ||| || ||||| ||||||||| | ||  || |||||||||||| |||| ||| |||| || |||||||| || |||||||||||| ||||    
31576644 cgattctcaggggaaacaatgcttggccaatgcgtgtgcctctacgcatgagccggcttagtcgtccatctttgatgtgtcggaaaccggtgcaaaag 31576547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #56
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 19 - 116
Target Start/End: Complemental strand, 33004112 - 33004015
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    ||||| |||| || ||||| ||||||||||| |||||| ||||||||| || |||||||| ||   ||||  || ||||| | |||||||||||||||    
33004112 cgatttccaggggaaacaatgcttggccagtgcgcatgcctctacgcacgagccggattagtcacccaccaatggtgggtcgaaaaccggtgcgaaag 33004015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #57
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 85 - 117
Target Start/End: Original strand, 40702591 - 40702623
Alignment:
85 cacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||||||| ||||||||||||||||||    
40702591 cacctttgatgggtcggaaaccggtgcgaaagc 40702623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0001 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: scaffold0001
Description:

Target: scaffold0001; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 30 - 117
Target Start/End: Complemental strand, 65237 - 65150
Alignment:
30 gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||||||||||||| ||||||||||||||||||| | |||||| ||| |||| |||||| | | ||||||||||||||||||    
65237 gggaacaacgcttggccagtgcgcatgtctctacgcatgagctggattagtcgctcacttttgatagatcggaaaccggtgcgaaagc 65150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0010 (Bit Score: 51; Significance: 3e-20; HSPs: 2)
Name: scaffold0010
Description:

Target: scaffold0010; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 155807 - 155709
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||| |||||||||||||||| ||| |||||| ||||||||| || |||||||| |||  |||||||| ||||| |||| |||||||||||||    
155807 cgattcccagggggaacaacgcttggctagtgcgcatgcctctacgcacgagccggattagtcgcccacctttggtgggtcggaagccggtgcgaaagc 155709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0010; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 19 - 115
Target Start/End: Complemental strand, 25880 - 25784
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaa 115  Q
    ||||||| || | |||||||||||||||||| |||||| |||||||| |||||| ||||| ||   |||||||  |||||  |||||||||||||||    
25880 cgattcctagggagaacaacgcttggccagtgcgcatgactctacgcgtgaaccagattagtcacccacctttactgggtcagaaaccggtgcgaaa 25784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0376 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: scaffold0376
Description:

Target: scaffold0376; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 31 - 116
Target Start/End: Original strand, 12695 - 12780
Alignment:
31 ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    |||||||||||||||||||  ||||| ||||||||| ||||||||||| |||  ||||||||||||||  ||||||||||||||||    
12695 ggaacaacgcttggccagtgtgcatgcctctacgcacgaaccggattagtcgcccacctttgatgggtcagaaaccggtgcgaaag 12780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0209 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: scaffold0209
Description:

Target: scaffold0209; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 29 - 117
Target Start/End: Original strand, 12596 - 12684
Alignment:
29 agggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||||||||||| ||||| |||||| ||||||||||||  ||||||| |||  |||||||||||| || |||||||||||||||||    
12596 agggaacaacgcttgaccagtgcgcatgcctctacgcatgagtcggattagtcgcccacctttgatggattagaaaccggtgcgaaagc 12684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0223 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: scaffold0223
Description:

Target: scaffold0223; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 33 - 116
Target Start/End: Original strand, 16906 - 16989
Alignment:
33 aacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    |||||||||||| |||| || ||||||||||||| || || ||||| ||| ||||||||| |||||||||||||| ||||||||    
16906 aacaacgcttggtcagtgcgtatgtctctacgcacgagccagattagtcgctcacctttggtgggttggaaaccgatgcgaaag 16989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0170 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: scaffold0170
Description:

Target: scaffold0170; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 19 - 98
Target Start/End: Original strand, 9858 - 9937
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggt 98  Q
    ||||| |||| |||||||||||||||||||| |||||| ||||||||| || |||||||| |||| |||||||| |||||    
9858 cgatttccagggggaacaacgcttggccagtgcgcatgcctctacgcacgagccggattagtcgtccacctttggtgggt 9937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002 (Bit Score: 44; Significance: 4e-16; HSPs: 2)
Name: scaffold0002
Description:

Target: scaffold0002; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 30 - 117
Target Start/End: Original strand, 319446 - 319533
Alignment:
30 gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||||||||||||||||| |||||  ||||| |||||| | |||||| |||| |||||||| ||||  ||||||||||||||||||    
319446 gggaacaacgcttggccagtgcgcatccctctatgcatgagctggattagtcgtccacctttggtggggcggaaaccggtgcgaaagc 319533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 583 - 681
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    |||||| ||| ||||||||| ||||  ||||  ||||| ||||||| |||| || ||||| ||| ||||||||| ||||| ||||||||||||||||||    
583 cgattcgcagggggaacaacacttgatcagtgtgcatgcctctacgtatgagccagattagtcgctcacctttggtgggtcggaaaccggtgcgaaagc 681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0041 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: scaffold0041
Description:

Target: scaffold0041; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 25109 - 25195
Alignment:
30 gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    |||||||||  |||| |||| ||||||| |||||||||||| | |||||||||| |||||||| ||| | |||||||||||||||||    
25109 gggaacaacatttggacagtgcgcatgtttctacgcatgaatcagattaatcgtccacctttggtggatcggaaaccggtgcgaaag 25195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0086 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: scaffold0086
Description:

Target: scaffold0086; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 19 - 116
Target Start/End: Original strand, 26196 - 26293
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    ||||| |||| ||||||||||||||||||||  ||||| ||||||||| || |||||||| |||| |||  |||||| || ||||||| |||||||||    
26196 cgatttccagggggaacaacgcttggccagtgtgcatgcctctacgcacgagccggattagtcgtccacaattgatgagtcggaaaccagtgcgaaag 26293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0009 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: scaffold0009
Description:

Target: scaffold0009; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 19 - 116
Target Start/End: Complemental strand, 42928 - 42831
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    ||||||| || | |||||| |||||| |||| |||||| |||||| ||||| |||||||| |||  |||||||| ||||| |||||||||||||||||    
42928 cgattcctagggagaacaatgcttggtcagtgcgcatgcctctacacatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag 42831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0316 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold0316
Description:

Target: scaffold0316; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 1710 - 1612
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||| |||| |||||||||| || |||||| |||||| |||||||||||| ||  |||| |||  |||||||| ||||| | ||||||||||||||||    
1710 cgatttccagggggaacaacgattagccagtgcgcatgcctctacgcatgagccaaattagtcgcccacctttggtgggtcgaaaaccggtgcgaaagc 1612  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0013 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: scaffold0013
Description:

Target: scaffold0013; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 19 - 59
Target Start/End: Original strand, 51744 - 51784
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtct 59  Q
    ||||||||||||||||||||||||||||||| |||||||||    
51744 cgattcccagagggaacaacgcttggccagtgcgcatgtct 51784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0006 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: scaffold0006
Description:

Target: scaffold0006; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 19 - 113
Target Start/End: Original strand, 68530 - 68621
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcga 113  Q
    |||||||||| |||||||||||||||   || |||||| ||||||||| || |||||||| |||  |||||||| ||||| | ||||||||||||    
68530 cgattcccagggggaacaacgcttgg---gtgcgcatgcctctacgcacgagccggattagtcgcccacctttggtgggtcgaaaaccggtgcga 68621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005 (Bit Score: 37; Significance: 0.000000000006; HSPs: 3)
Name: scaffold0005
Description:

Target: scaffold0005; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 41 - 117
Target Start/End: Original strand, 219404 - 219480
Alignment:
41 ttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc 117  Q
    ||||||||| |||||| ||||||||| |||| |||||| |||| |||||||||||| | | |||||||||| |||||    
219404 ttggccagtgcgcatgcctctacgcacgaactggattagtcgtccacctttgatggatcgaaaaccggtgcaaaagc 219480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 41 - 116
Target Start/End: Complemental strand, 250099 - 250024
Alignment:
41 ttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    ||||||||| |||||| ||||||||| || |||||||| ||| || |||||| ||||| ||||| |||||||||||    
250099 ttggccagtgcgcatgcctctacgcacgagccggattagtcgctcgcctttggtgggtcggaaatcggtgcgaaag 250024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 19 - 66
Target Start/End: Complemental strand, 271170 - 271123
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgca 66  Q
    |||||||||| ||||||||||||||| |||| ||||||||||||||||    
271170 cgattcccagggggaacaacgcttggtcagtgcgcatgtctctacgca 271123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0341 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: scaffold0341
Description:

Target: scaffold0341; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 19 - 66
Target Start/End: Original strand, 18645 - 18692
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctacgca 66  Q
    ||||||| || |||||||||||||||||||| | ||||||||||||||    
18645 cgattcctagggggaacaacgcttggccagtgcacatgtctctacgca 18692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0011 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0011
Description:

Target: scaffold0011; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 58 - 116
Target Start/End: Original strand, 224369 - 224427
Alignment:
58 ctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag 116  Q
    ||||||||| || |||||||| |||| || ||||| ||||| |||||||||||||||||    
224369 ctctacgcacgagccggattagtcgtccatctttggtgggtcggaaaccggtgcgaaag 224427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0384 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: scaffold0384
Description:

Target: scaffold0384; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 34 - 107
Target Start/End: Original strand, 6000 - 6073
Alignment:
34 acaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccg 107  Q
    |||||||||||||||| | |||| ||||||||||||  || |||| |||| |||| ||| ||||| ||||||||    
6000 acaacgcttggccagtgcacatgcctctacgcatgagacgaattagtcgtccaccattggtgggtcggaaaccg 6073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0079 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0079
Description:

Target: scaffold0079; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 63
Target Start/End: Original strand, 8188 - 8231
Alignment:
19 cgattcccagagggaacaacgcttggccagtacgcatgtctctac 63  Q
    ||||||||| ||||||||||||||||||||| |||||| ||||||    
8188 cgattccca-agggaacaacgcttggccagtgcgcatgcctctac 8231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University