View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2470_low_7 (Length: 255)
Name: NF2470_low_7
Description: NF2470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2470_low_7 |
 |  |
|
| [»] scaffold0291 (1 HSPs) |
 |  |  |
|
| [»] scaffold0016 (1 HSPs) |
 |  |  |
|
| [»] scaffold0001 (1 HSPs) |
 |  |  |
|
| [»] scaffold0010 (2 HSPs) |
 |  |  |
|
| [»] scaffold0376 (1 HSPs) |
 |  |  |
|
| [»] scaffold0209 (1 HSPs) |
 |  |  |
|
| [»] scaffold0223 (1 HSPs) |
 |  |  |
|
| [»] scaffold0170 (1 HSPs) |
 |  |  |
|
| [»] scaffold0002 (2 HSPs) |
 |  |  |
|
| [»] scaffold0041 (1 HSPs) |
 |  |  |
|
| [»] scaffold0086 (1 HSPs) |
 |  |  |
|
| [»] scaffold0009 (1 HSPs) |
 |  |  |
|
| [»] scaffold0316 (1 HSPs) |
 |  |  |
|
| [»] scaffold0013 (1 HSPs) |
 |  |  |
|
| [»] scaffold0006 (1 HSPs) |
 |  |  |
|
| [»] scaffold0005 (3 HSPs) |
 |  |  |
|
| [»] scaffold0341 (1 HSPs) |
 |  |  |
|
| [»] scaffold0011 (1 HSPs) |
 |  |  |
|
| [»] scaffold0384 (1 HSPs) |
 |  |  |
|
| [»] scaffold0079 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 143; Significance: 3e-75; HSPs: 62)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 19 - 243
Target Start/End: Original strand, 52950097 - 52950322
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagcn |
118 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |||||| |||||| |||||||| ||||| |||| |||||||| ||||| |||||||| ||||||||| |
|
|
| T |
52950097 |
cgattcccagggggaacaacgcttggccagtgcgcatgactctacacatgaaccagattagtcgtccacctttggtgggtcggaaaccgatgcgaaagca |
52950196 |
T |
 |
| Q |
119 |
nnnnnnnn-tgtcatggtcttaagcccaaactaaagcatcacagataaatggtgcatataattacatgtgtcacttagctcatgaaaataaaaattatat |
217 |
Q |
| |
|
|||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52950197 |
aaaaaaaaatgtcctagtcttaagcccaaactaaagcatcacagataaatggtgcatataattacatgtgtcacttagctcatgaaaataaaaattatat |
52950296 |
T |
 |
| Q |
218 |
atatgcaccacatagtacttaagaat |
243 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
52950297 |
atatgcaccacatagtacttaagaat |
52950322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 53599075 - 53599173
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||| ||||||||| ||||||||| |||||| |||||||||||| ||||||||||||||||||||| ||| | |||||||||||||||||| |
|
|
| T |
53599075 |
cgattcccaggaggaacaacgtttggccagtgcgcatgcctctacgcatgagccggattaatcgttcacctttagtggatcggaaaccggtgcgaaagc |
53599173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 55921049 - 55921147
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||| ||||||||| ||||| |||| |||||| ||||||| |||| |||||||||||| ||||||||| ||||| |||||||||||||||||| |
|
|
| T |
55921049 |
cgattcccagggggaacaacacttggtcagtgcgcatgcctctacgtatgagccggattaatcgctcacctttggtgggtcggaaaccggtgcgaaagc |
55921147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 19 - 116
Target Start/End: Complemental strand, 7246742 - 7246645
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
||||||| || |||||||||||||||||||| |||||| |||||||||||| |||||||| ||| |||||||| ||||| ||||||||||||||||| |
|
|
| T |
7246742 |
cgattcctagtgggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag |
7246645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 20 - 117
Target Start/End: Original strand, 38166043 - 38166140
Alignment:
| Q |
20 |
gattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||| ||||||||| || |||||||| ||| |||||||| ||||| |||||||||||||||||| |
|
|
| T |
38166043 |
gattcccagggggaacaacgcttggccagtgcgcatggctctacgcacgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc |
38166140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 21 - 116
Target Start/End: Complemental strand, 42722671 - 42722576
Alignment:
| Q |
21 |
attcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||||| |||||||||||| |||||||| |||||||||||| ||||| | ||||||||||||||| |
|
|
| T |
42722671 |
attcccaggaggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgttcacctttagtgggtcgaaaaccggtgcgaaag |
42722576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 16450315 - 16450413
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||| |||||||||||||||||||| | |||| |||||||||||| || ||||| |||| |||||||| | ||| |||||||||||||||||| |
|
|
| T |
16450315 |
cgattcccagggggaacaacgcttggccagtgcacatgcctctacgcatgagccagattagtcgtccacctttggtaggtcggaaaccggtgcgaaagc |
16450413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 31 - 117
Target Start/End: Original strand, 38168284 - 38168369
Alignment:
| Q |
31 |
ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||||||||||||||| | |||| |||||||||||| |||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
38168284 |
ggaacaacgcttggccagtgc-catgcctctacgcatgagccggattagtcgttcacctttagtgggttggaaaccggtgcgaaagc |
38168369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 19 - 116
Target Start/End: Original strand, 29895802 - 29895899
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
|||||||||| ||||||||| |||||||||| |||||| |||||||||||| |||||||| |||| |||| ||| ||| | ||||||||||||||||| |
|
|
| T |
29895802 |
cgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgtccaccattggtggttcggaaaccggtgcgaaag |
29895899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 30 - 115
Target Start/End: Complemental strand, 40780946 - 40780861
Alignment:
| Q |
30 |
gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaa |
115 |
Q |
| |
|
||||||||||||||| |||| |||||| |||||||||||| |||||||| |||| |||||||| ||||| |||||||||||||||| |
|
|
| T |
40780946 |
gggaacaacgcttggtcagtgcgcatgcctctacgcatgagccggattagtcgtccacctttggtgggtcggaaaccggtgcgaaa |
40780861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 30 - 117
Target Start/End: Original strand, 17080069 - 17080156
Alignment:
| Q |
30 |
gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||||||||||||| |||||| |||||||||||| |||||||| ||| |||||||||||| | | |||||||||||||||| |
|
|
| T |
17080069 |
gggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgcacacctttgatggatcgaaaaccggtgcgaaagc |
17080156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 31 - 117
Target Start/End: Original strand, 4738645 - 4738731
Alignment:
| Q |
31 |
ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||||| | | |||| |||| |||||||| ||||| |||||||||||||||||| |
|
|
| T |
4738645 |
ggaacaacgctttgccagtgcgcatgtctctacgcatgagctgaattagtcgtccacctttggtgggtcggaaaccggtgcgaaagc |
4738731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 38075448 - 38075546
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||| ||| || ||||||||||||||||| |||||| |||||||||||| ||| |||||| || |||||||| ||||| |||||||| ||||||||| |
|
|
| T |
38075448 |
cgattctcaggggaaacaacgcttggccagtgcgcatgcctctacgcatgagccgaattaattgtccacctttggtgggtcggaaaccgatgcgaaagc |
38075546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 47078473 - 47078571
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||| |||||||||||||||||||| | |||| ||||||||| || |||||||| ||| ||||| ||| ||||| ||||||| |||||||||| |
|
|
| T |
47078473 |
cgattcccagggggaacaacgcttggccagtgcacatgcctctacgcacgagccggattagtcgctcaccattggtgggtcggaaaccagtgcgaaagc |
47078571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 31 - 116
Target Start/End: Original strand, 2559334 - 2559419
Alignment:
| Q |
31 |
ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||| | |||||||| |||| |||||||| ||||| ||||||||||||||||| |
|
|
| T |
2559334 |
ggaacaacgcttggccagtgcgcatgcctctacgcacaagccggattactcgtccacctttggtgggtcggaaaccggtgcgaaag |
2559419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 19 - 116
Target Start/End: Original strand, 14124031 - 14124128
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
|||||||||| ||||||||| ||||||||| |||||| |||||| || || |||||||| ||| ||||| ||| ||||||||||||||||||||||| |
|
|
| T |
14124031 |
cgattcccagggggaacaacatttggccagtgcgcatgcctctacacacgagccggattagtcgctcaccattggtgggttggaaaccggtgcgaaag |
14124128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 19 - 115
Target Start/End: Original strand, 13073553 - 13073649
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaa |
115 |
Q |
| |
|
||||||||| |||||||| | ||||||||| ||||| ||||||||||||||| ||||| ||||| ||||||| ||||| |||||||||||||||| |
|
|
| T |
13073553 |
cgattcccatggggaacaatgtttggccagtgcgcatacctctacgcatgaaccagattagtcgtttacctttggtgggtcggaaaccggtgcgaaa |
13073649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 19 - 114
Target Start/End: Complemental strand, 295628 - 295534
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaa |
114 |
Q |
| |
|
||||||||||||| ||||||| ||||||||| |||||| ||||||||| ||||| ||||| |||| |||| ||| |||||| |||||||||||||| |
|
|
| T |
295628 |
cgattcccagagg-aacaacgtttggccagtgcgcatgcctctacgcacgaaccagattagtcgtccaccgttggtgggtttgaaaccggtgcgaa |
295534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 19 - 110
Target Start/End: Original strand, 8889037 - 8889128
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtg |
110 |
Q |
| |
|
||||||| || ||||||||| ||||| |||| |||||| |||||||||||| |||||||| |||| |||||||| ||||| ||||||||||| |
|
|
| T |
8889037 |
cgattcctagggggaacaacacttgggcagtgcgcatggctctacgcatgagccggattagtcgtccacctttggtgggtcggaaaccggtg |
8889128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 20 - 116
Target Start/End: Original strand, 31588700 - 31588798
Alignment:
| Q |
20 |
gattcccagagggaacaacgct--tggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
|||||||||||| ||||||||| |||||||| ||||||||||||||||||| |||||||| ||| |||| |||| ||| | |||||||| |||||||| |
|
|
| T |
31588700 |
gattcccagaggaaacaacgctcttggccagtgcgcatgtctctacgcatgagccggattagtcgctcacttttggtggatcggaaaccgatgcgaaag |
31588798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 20421788 - 20421886
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||| |||| ||||||||| |||||||||| |||||| |||||||||||| || |||||||||| || | ||||||||| ||||||| || ||||||| |
|
|
| T |
20421788 |
cgatttccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccagattaatcgtccatcattgatgggtcggaaaccagttcgaaagc |
20421886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 36145311 - 36145213
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||| || ||||||||||| |||| |||||| |||||| ||||| |||||||| |||| ||||||||||| | |||||||||||||||||| |
|
|
| T |
36145311 |
cgattcccaggggaaacaacgcttgatcagtgcgcatgcctctacacatgagccggattagtcgtccacctttgatgaatcggaaaccggtgcgaaagc |
36145213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 19 - 116
Target Start/End: Original strand, 30317248 - 30317345
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| ||| ||||||||| || ||| |||| ||| |||||||| ||||| |||||||| || ||||| |
|
|
| T |
30317248 |
cgattctcagagggaacaacgcttggccagtacgaatgcctctacgcacgagccgaattagtcgcccacctttggtgggtcggaaaccgatgtgaaag |
30317345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 19 - 116
Target Start/End: Original strand, 43458628 - 43458725
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
|||||||||| |||| |||||||||||||| |||||| ||||||| | || |||||||| |||| ||||||||||| || |||||||| |||||||| |
|
|
| T |
43458628 |
cgattcccaggaggaagaacgcttggccagtgcgcatgcctctacggacgagccggattagtcgtccacctttgatgagtcggaaaccgttgcgaaag |
43458725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 19 - 116
Target Start/End: Original strand, 43468362 - 43468459
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
|||||||||| |||||||||||||||||||| | ||| ||||||||||||| |||||||| ||| |||| || ||||| ||| ||||||||||||| |
|
|
| T |
43468362 |
cgattcccagggggaacaacgcttggccagtgcacatttctctacgcatgagccggattagtcgcccaccagtggtgggtcggagaccggtgcgaaag |
43468459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 25 - 117
Target Start/End: Complemental strand, 3159559 - 3159467
Alignment:
| Q |
25 |
ccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||| |||||||||||||||||||| |||||| ||||||||| || || ||||| ||| ||||| ||| ||||| |||||||||||| ||||| |
|
|
| T |
3159559 |
ccagggggaacaacgcttggccagtgcgcatgcctctacgcacgagccagattagtcgctcaccattggtgggtcggaaaccggtgcaaaagc |
3159467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 21 - 117
Target Start/End: Complemental strand, 49260759 - 49260663
Alignment:
| Q |
21 |
attcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||| |||||||||||||||||||| |||||| ||||||||| || |||||||| ||| |||||||| ||||| ||||| |||||| ||||| |
|
|
| T |
49260759 |
attcccaaggggaacaacgcttggccagtgcgcatgcctctacgcacgagccggattagtcgaccacctttggtgggtcggaaatcggtgcaaaagc |
49260663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 33 - 116
Target Start/End: Complemental strand, 49952228 - 49952144
Alignment:
| Q |
33 |
aacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgt-tcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
||||||| |||| |||| |||| | |||||||||||| |||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
49952228 |
aacaacgtttggtcagtgcgcacgcctctacgcatgagccggattagtcgcgtcacctttgatgggttggaaaccggtgcgaaag |
49952144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 58 - 117
Target Start/End: Complemental strand, 25406620 - 25406561
Alignment:
| Q |
58 |
ctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||||||||| | ||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
25406620 |
ctctacgcatgaatcagattagtcgttcacctttgatgggtcggaaaccggtgcgaaagc |
25406561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 10541031 - 10541128
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||| |||| || ||||||||||||||||| ||||| ||||||||| || || ||||||||| |||||||||||| | |||||||||||||||||| |
|
|
| T |
10541031 |
cgatttccaggggaaacaacgcttggccagtgtgcatgcctctacgcacgagccagattaatcg-ccacctttgatggatcggaaaccggtgcgaaagc |
10541128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 48015169 - 48015071
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |||| | ||||||||| || |||||||| | | || |||||||| | |||||||||||||||||| |
|
|
| T |
48015169 |
cgattcccagtgggaacaacgcttggccagtgcgcaagcctctacgcacgagccggattagtagcccaattttgatggatcggaaaccggtgcgaaagc |
48015071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 19 - 88
Target Start/End: Original strand, 1446841 - 1446910
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacc |
88 |
Q |
| |
|
|||||||||| ||||||||| |||||||||| |||||| |||||||||||| |||||||| |||| |||| |
|
|
| T |
1446841 |
cgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgtccacc |
1446910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 20 - 117
Target Start/End: Complemental strand, 5472943 - 5472846
Alignment:
| Q |
20 |
gattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||| ||| || ||||||||||||||||| |||||| ||||||||| || |||||||| ||| |||||||| ||||| | |||| ||||||||||| |
|
|
| T |
5472943 |
gattctcaggggaaacaacgcttggccagtgcgcatgcctctacgcacgagccggattagtcgcccacctttggtgggtcgaaaactggtgcgaaagc |
5472846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 30 - 117
Target Start/End: Complemental strand, 47682467 - 47682380
Alignment:
| Q |
30 |
gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||| |||| ||||||||| | |||||||||||||| || |||| ||| ||| |||||||| ||||| |||||||||||||||||| |
|
|
| T |
47682467 |
gggaataacgtttggccagtgcacatgtctctacgcacgagccgggttagtcgcccacctttggtgggtcggaaaccggtgcgaaagc |
47682380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 24166465 - 24166563
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||||| || ||||||| ||||||||| |||||| ||||||||| || || ||||| || |||||||||||| | |||||||||||||||||| |
|
|
| T |
24166465 |
cgattcccaagggaaacaacgtttggccagtgcgcatgcctctacgcacgagccagattagtcacccacctttgatggatcggaaaccggtgcgaaagc |
24166563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 24 - 117
Target Start/End: Original strand, 18531539 - 18531632
Alignment:
| Q |
24 |
cccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||| ||||||||| ||||| |||| |||||| ||| | ||| ||||| ||||| |||| ||||||| ||||| |||||||||||||||||| |
|
|
| T |
18531539 |
cccagggggaacaacacttggtcagtgcgcatgcctccatgcacgaaccagattattcgtccaccttttgtgggtcggaaaccggtgcgaaagc |
18531632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 19 - 113
Target Start/End: Complemental strand, 1940870 - 1940779
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcga |
113 |
Q |
| |
|
|||||||||| ||||||||||||||| || |||||| ||||||||| || |||||||| ||| |||||||| ||||| | |||||||||||| |
|
|
| T |
1940870 |
cgattcccagggggaacaacgcttgg---gtgcgcatgcctctacgcacgagccggattagtcgcccacctttggtgggtcgaaaaccggtgcga |
1940779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 41 - 117
Target Start/End: Complemental strand, 14597974 - 14597898
Alignment:
| Q |
41 |
ttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||||| |||||| ||||||||| |||| |||||| |||| |||||||||||| | | |||||||||| ||||| |
|
|
| T |
14597974 |
ttggccagtgcgcatgcctctacgcacgaactggattagtcgtccacctttgatggatcgaaaaccggtgcaaaagc |
14597898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 36 - 116
Target Start/End: Complemental strand, 15840014 - 15839934
Alignment:
| Q |
36 |
aacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
|||| ||||||||| |||||| |||||||||||| |||||||| ||| | ||||||| ||||||||||| ||||||||| |
|
|
| T |
15840014 |
aacgtttggccagtgcgcatgcctctacgcatgagccggattagtcgcccttctttgataggttggaaaccagtgcgaaag |
15839934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 19 - 115
Target Start/End: Original strand, 33647736 - 33647832
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaa |
115 |
Q |
| |
|
||||| |||| | |||||||||||| ||||| | ||| ||||||||| ||||| ||||| ||||||| ||||| ||| | |||||||||||||||| |
|
|
| T |
33647736 |
cgatttccagggagaacaacgcttgaccagtgcacattcctctacgcacgaaccagattagtcgttcatctttggtggatcggaaaccggtgcgaaa |
33647832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 30 - 106
Target Start/End: Complemental strand, 40272416 - 40272340
Alignment:
| Q |
30 |
gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaacc |
106 |
Q |
| |
|
|||||||||||||||||||| |||||| |||||||||| | |||||| ||||||||| ||| ||||| ||||||| |
|
|
| T |
40272416 |
gggaacaacgcttggccagtgcgcatgcctctacgcataagtcggatttgtcgttcaccattggtgggtcggaaacc |
40272340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 33 - 116
Target Start/End: Complemental strand, 2686537 - 2686454
Alignment:
| Q |
33 |
aacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
|||||| |||| ||| ||| |||||||||| ||||| ||| |||| |||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
2686537 |
aacaacacttgaccactacatatgtctctacacatgagccgaattagtcgtccaccttttgtgggttggaaaccggtgcgaaag |
2686454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 41 - 116
Target Start/End: Original strand, 14567276 - 14567351
Alignment:
| Q |
41 |
ttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
||||||||| |||||| ||||||||| || |||||||| ||| || |||||| ||||| ||||| ||||||||||| |
|
|
| T |
14567276 |
ttggccagtgcgcatgcctctacgcacgagccggattagtcgctcgcctttggtgggtcggaaatcggtgcgaaag |
14567351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 22 - 117
Target Start/End: Original strand, 14858729 - 14858823
Alignment:
| Q |
22 |
ttcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||| |||| ||| ||||| ||||| |||||||||||||| | || | ||||| |||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
14858729 |
ttcccagggggatcaa-gcttgaccagtgcgcatgtctctacgtacgagtcagattattcgtccacctttgatgggtcagaaaccggtgcgaaagc |
14858823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 37 - 115
Target Start/End: Complemental strand, 6032721 - 6032643
Alignment:
| Q |
37 |
acgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaa |
115 |
Q |
| |
|
||||||| ||||| | |||| ||||||| |||| |||||||| |||| ||||||| ||||| |||||||||||||||| |
|
|
| T |
6032721 |
acgcttgaccagtgctcatgcctctacgaatgagccggattagtcgtctacctttggtgggtcggaaaccggtgcgaaa |
6032643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 20128324 - 20128422
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||| ||| |||||||| ||||||||||| |||||| || |||||| || | ||||| |||| |||| ||| ||||| ||||||||||||||||| |
|
|
| T |
20128324 |
cgattctcagggggaacaatgcttggccagtgcgcatgcctttacgcacgagctagattagtcgtccaccattggtgggtcagaaaccggtgcgaaagc |
20128422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 32 - 106
Target Start/End: Original strand, 20354665 - 20354739
Alignment:
| Q |
32 |
gaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaacc |
106 |
Q |
| |
|
|||||||||||||| ||| |||||| |||||||||||| ||||||| |||| ||| |||||| |||||||||| |
|
|
| T |
20354665 |
gaacaacgcttggctagtgcgcatgcctctacgcatgagtcggattagtcgtccactattgatgagttggaaacc |
20354739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 19 - 116
Target Start/End: Complemental strand, 8064894 - 8064797
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
||||||||| ||||| ||| |||| ||||| |||||| |||||||||||| |||||||| |||| |||| || || ||| | |||||||||| |||| |
|
|
| T |
8064894 |
cgattcccaaggggaataacacttgaccagtgcgcatgcctctacgcatgagccggattagtcgtccaccattaataggtcgaaaaccggtgcaaaag |
8064797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 32 - 117
Target Start/End: Original strand, 16645146 - 16645231
Alignment:
| Q |
32 |
gaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||||||||||| ||||| |||||| ||||| | ||||| ||| ||||| || ||||| |||||||||||||||||| |
|
|
| T |
16645146 |
gaacaacgcttggccagtgtgcatgcctctacacatgagtctgattagtcgcccacctgtggtgggtcggaaaccggtgcgaaagc |
16645231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 31 - 76
Target Start/End: Complemental strand, 20532493 - 20532448
Alignment:
| Q |
31 |
ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggat |
76 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||||||| |||||| |
|
|
| T |
20532493 |
ggaacaacgcttggccagtgcgcatgcctctacgcatgagccggat |
20532448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 26480034 - 26479981
Alignment:
| Q |
30 |
gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgt |
83 |
Q |
| |
|
||||| ||| ||||||||||||||||| |||||||||||| ||| ||||||||| |
|
|
| T |
26480034 |
gggaataacacttggccagtacgcatgcctctacgcatgagccgaattaatcgt |
26479981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 30 - 107
Target Start/End: Original strand, 46108717 - 46108794
Alignment:
| Q |
30 |
gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccg |
107 |
Q |
| |
|
||||||||| ||||| ||| |||||| |||||||||||| || ||||| |||| ||| |||||||||| |||||||| |
|
|
| T |
46108717 |
gggaacaacatttggctagtgcgcatgcctctacgcatgagccagattagtcgtccacttttgatgggtcggaaaccg |
46108794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 31 - 115
Target Start/End: Original strand, 14859318 - 14859402
Alignment:
| Q |
31 |
ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaa |
115 |
Q |
| |
|
||||||| | ||| ||||| |||||||||||||||| || || ||||| || | ||||||||||| || |||||| ||||||||| |
|
|
| T |
14859318 |
ggaacaatgtttgaccagtgcgcatgtctctacgcacgagccagattagtcatccacctttgatgtgtcggaaactggtgcgaaa |
14859402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 30 - 114
Target Start/End: Original strand, 21429327 - 21429411
Alignment:
| Q |
30 |
gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaa |
114 |
Q |
| |
|
|||||||||| || |||||| |||||| ||||||||| || | || || |||| |||||||| ||||| ||||||||||||||| |
|
|
| T |
21429327 |
gggaacaacgtttagccagtgcgcatgcctctacgcacgagtcagactagtcgtccacctttggtgggtcggaaaccggtgcgaa |
21429411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 29 - 117
Target Start/End: Complemental strand, 36262853 - 36262765
Alignment:
| Q |
29 |
agggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||||||||||||||||| | |||| ||||||||| || ||||||| ||| |||||||| ||||| |||||| ||||||||| |
|
|
| T |
36262853 |
agggaacaacgcttggccagtgcacatgcctctacgcacgagtcggattagtcgcccacctttggtgggtcagaaaccaatgcgaaagc |
36262765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 72 - 116
Target Start/End: Original strand, 45721154 - 45721198
Alignment:
| Q |
72 |
cggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
||||||| |||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
45721154 |
cggattagtcgtccacctttaatgggttggaaaccggtgcgaaag |
45721198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 31 - 111
Target Start/End: Complemental strand, 48317359 - 48317279
Alignment:
| Q |
31 |
ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgc |
111 |
Q |
| |
|
|||||||||||||| |||| | ||| ||||||||| || |||||||| ||| |||| ||||||||||||||||| |||| |
|
|
| T |
48317359 |
ggaacaacgcttggtcagtgtgtatgcctctacgcacgagccggattagtcgcccaccgttgatgggttggaaaccagtgc |
48317279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 32 - 104
Target Start/End: Original strand, 53354560 - 53354632
Alignment:
| Q |
32 |
gaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaa |
104 |
Q |
| |
|
||||||| ||| ||||| |||||| |||||||||| || ||||||| ||||||| ||||||||||| ||||| |
|
|
| T |
53354560 |
gaacaacacttaaccagtgcgcatgcctctacgcataaatcggattagtcgttcatctttgatgggtcggaaa |
53354632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 105
Target Start/End: Original strand, 3507286 - 3507371
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaac |
105 |
Q |
| |
|
||||||||| ||||||||||||||||| ||| ||| || |||||| || || |||||||| |||| |||||||| ||| | |||||| |
|
|
| T |
3507286 |
cgattccca-agggaacaacgcttggctagtgcgcgtgcctctacacacgagccggattagtcgtccacctttggtggatcggaaac |
3507371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 31 - 117
Target Start/End: Original strand, 21192667 - 21192753
Alignment:
| Q |
31 |
ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||||| | ||||||| |||||| ||||||||| || ||||||||||| ||| |||| || || | |||||||||||||||| |
|
|
| T |
21192667 |
ggaacaacgttgggccagtgcgcatgcctctacgcacgagtcggattaatcgcccacatttggtgagtcgaaaaccggtgcgaaagc |
21192753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 40 - 78
Target Start/End: Original strand, 33109360 - 33109398
Alignment:
| Q |
40 |
cttggccagtacgcatgtctctacgcatgaaccggatta |
78 |
Q |
| |
|
||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
33109360 |
cttggccagtacgcatgtctctacgcacgagccggatta |
33109398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 29 - 109
Target Start/End: Original strand, 52209637 - 52209717
Alignment:
| Q |
29 |
agggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggt |
109 |
Q |
| |
|
|||||||||||||||| ||| |||| | ||||||||||| | ||||||||||||| | ||||||||| ||||||||| |
|
|
| T |
52209637 |
agggaacaacgcttggatagtgcgcacgcttctacgcatgagtcagattaatcgttcatcattgatgggtcagaaaccggt |
52209717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0291 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: scaffold0291
Description:
Target: scaffold0291; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 6868 - 6966
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||| ||||||||| |||||||||| |||||| |||||||||||| |||||||| ||| ||||||||| ||||| |||||||||||||||||| |
|
|
| T |
6868 |
cgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgctcacctttggtgggtcggaaaccggtgcgaaagc |
6966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 63; Significance: 2e-27; HSPs: 41)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 5253319 - 5253221
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||| ||||||||| |||||||||| |||||| |||||||||||| |||||||||||| |||||||| ||||| |||||||||||||||||| |
|
|
| T |
5253319 |
cgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattaatcgcccacctttggtgggtcggaaaccggtgcgaaagc |
5253221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 21898662 - 21898760
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |||||| |||||||||||| |||||||| |||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
21898662 |
cgattcccaggaggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgttcacctttagtgggtcggaaaccggtgcgaaagc |
21898760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 8932675 - 8932773
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||| ||||||||| |||||| ||| |||||| |||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
8932675 |
cgattcccagggggaacaacacttggctagtgcgcatgcctctacgcatgagccggattaatcacccacctttgatgggtcggaaaccggtgcgaaagc |
8932773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 8944141 - 8944239
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||| ||||||||| |||||| ||| |||||| |||||||||||| ||||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
8944141 |
cgattcccagggggaacaacacttggctagtgcgcatgcctctacgcatgagccggattaatcacccacctttgatgggtcggaaaccggtgcgaaagc |
8944239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 3601098 - 3601196
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||| ||| |||||||||||||||||||| |||||| || ||| || || |||||||| |||| |||||||| ||||| |||||||||||||||||| |
|
|
| T |
3601098 |
cgattctcagggggaacaacgcttggccagtgcgcatgcctatacacacgagccggattagtcgtccacctttggtgggtcggaaaccggtgcgaaagc |
3601196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 32 - 117
Target Start/End: Complemental strand, 9633708 - 9633623
Alignment:
| Q |
32 |
gaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||||| || |||||||| ||| |||||||| ||||| |||||||||||||||||| |
|
|
| T |
9633708 |
gaacaacgcttggccagtgcgcatgcctctacgcacgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc |
9633623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 20 - 117
Target Start/End: Original strand, 19089513 - 19089610
Alignment:
| Q |
20 |
gattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||||| ||||||||| |||||||||| ||||| ||||||||| || |||||||| |||| ||||||| ||||| |||||||||||||||||| |
|
|
| T |
19089513 |
gattcccagggggaacaacacttggccagtgagcatgcctctacgcacgagccggattagtcgtctacctttggtgggtcggaaaccggtgcgaaagc |
19089610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 3588041 - 3587943
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||||| |||||||||||||||||||| | ||| ||||||||||||||||||||| |||| ||||||||||| | |||||| | ||||||||| |
|
|
| T |
3588041 |
cgattcccaaggggaacaacgcttggccagtgcacatacctctacgcatgaaccggattagtcgtcaacctttgatggatcggaaactgatgcgaaagc |
3587943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 6606193 - 6606095
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||| ||| ||||||||| |||||||||| |||| |||||||||||| |||||||| |||| |||| ||| ||||| |||||||||||||||||| |
|
|
| T |
6606193 |
cgattctcagggggaacaacacttggccagtgtacatgcctctacgcatgagccggattagtcgtccaccattggtgggtcggaaaccggtgcgaaagc |
6606095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 12606444 - 12606542
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||| |||| |||||||||| ||||||||| |||||| ||||||||| || |||||||| ||| |||||||| || | ||||||||||||||||||| |
|
|
| T |
12606444 |
cgatttccagggggaacaacgtttggccagtgcgcatgcctctacgcacgagccggattagtcgcccacctttggtgagctggaaaccggtgcgaaagc |
12606542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 19 - 116
Target Start/End: Original strand, 8938725 - 8938822
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
|||||||||| |||||||| |||| ||||| |||| | ||||||||||| ||| |||| |||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
8938725 |
cgattcccaggaggaacaacacttgaccagtgcgcaagcatctacgcatgagccgaattagtcgtccacctttgatgggtcggaaaccggtgcgaaag |
8938822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 32 - 111
Target Start/End: Complemental strand, 2271386 - 2271307
Alignment:
| Q |
32 |
gaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgc |
111 |
Q |
| |
|
||||||||||| |||||| |||||||||||||||| || |||||||| |||| |||||||||||||| |||||| |||| |
|
|
| T |
2271386 |
gaacaacgcttagccagtgcgcatgtctctacgcacgagccggattagtcgtccacctttgatgggtcagaaaccagtgc |
2271307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 30 - 117
Target Start/End: Complemental strand, 13036089 - 13036002
Alignment:
| Q |
30 |
gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||||| |||||||||| |||||| |||||||||||| || ||||| |||| ||| ||| ||||| |||||||||||||||||| |
|
|
| T |
13036089 |
gggaacaacacttggccagtgcgcatgcctctacgcatgagccagattagtcgtccactattggtgggtcggaaaccggtgcgaaagc |
13036002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 30 - 117
Target Start/End: Complemental strand, 29444850 - 29444763
Alignment:
| Q |
30 |
gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||||||||||||| |||||| |||||||||||| |||||||| | || || ||||| ||||| |||||| |||||||||| |
|
|
| T |
29444850 |
gggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagttgtccatctttggtgggtcggaaactagtgcgaaagc |
29444763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 31 - 117
Target Start/End: Complemental strand, 8612058 - 8611972
Alignment:
| Q |
31 |
ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||||||||| ||||| ||||| |||||||||||||||||||| ||| |||||||| ||||| ||||||||||||||||| |
|
|
| T |
8612058 |
ggaacaacgcttgaccagtgtgcatgcttctacgcatgaaccggattagtcgcccacctttggtgggtcagaaaccggtgcgaaagc |
8611972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 31 - 117
Target Start/End: Complemental strand, 30788937 - 30788851
Alignment:
| Q |
31 |
ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||||| ||||||||| |||||| ||||| ||| || |||||||| ||| |||||||| ||||| |||||||||||||||||| |
|
|
| T |
30788937 |
ggaacaacgtttggccagtgcgcatgcctctaggcacgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc |
30788851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 34954715 - 34954617
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||| ||| |||||||||| ||||||||| | ||| |||||||||||| || ||||| |||| |||||||||||||| ||||||| ||||||||| |
|
|
| T |
34954715 |
cgattctcagggggaacaacgtttggccagtgcacatacctctacgcatgagccagattagtcgtccacctttgatgggtcggaaaccaatgcgaaagc |
34954617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 61 - 117
Target Start/End: Original strand, 21167431 - 21167487
Alignment:
| Q |
61 |
tacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||||| ||||||||||||| |||| ||||||||||| |||||||||||||||| |
|
|
| T |
21167431 |
tacgcatgagccggattaatcgtccaccattgatgggttgaaaaccggtgcgaaagc |
21167487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 21 - 117
Target Start/End: Original strand, 31129193 - 31129289
Alignment:
| Q |
21 |
attcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||| ||| |||| ||||||||||| ||| |||||| |||||||||||| || ||||| | || |||||||| || || |||||||||||||||||| |
|
|
| T |
31129193 |
attcacagggggagcaacgcttggctagtgcgcatgcctctacgcatgagccagattagttgtgcacctttggtgagtcggaaaccggtgcgaaagc |
31129289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 29333224 - 29333138
Alignment:
| Q |
30 |
gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
|||||||||| ||||||||| |||||| |||||||||||| ||| || | |||| |||||||| | ||| || |||||||||||||| |
|
|
| T |
29333224 |
gggaacaacgtttggccagtgcgcatgcctctacgcatgagccgaatcagtcgtccacctttggtaggtcggtaaccggtgcgaaag |
29333138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 31 - 117
Target Start/End: Original strand, 30410471 - 30410557
Alignment:
| Q |
31 |
ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||| ||| ||||| |||||| |||||||||||| | |||||||||| ||| ||||| ||||| |||||||| ||||||||| |
|
|
| T |
30410471 |
ggaacaacacttaaccagtgcgcatgcctctacgcatgagctggattaatcgctcatctttggtgggtcggaaaccgatgcgaaagc |
30410557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 116
Target Start/End: Complemental strand, 9179832 - 9179735
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
|||||||||| ||||||||| |||| |||||| |||| |||||||||||| | |||||| |||| |||||||| ||| | ||||| |||| |||||| |
|
|
| T |
9179832 |
cgattcccagggggaacaacacttgaccagtatgcatacctctacgcatgagctggattagtcgtccacctttggtggatcggaaatcggtccgaaag |
9179735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 20 - 117
Target Start/End: Original strand, 12635829 - 12635926
Alignment:
| Q |
20 |
gattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||||| || ||||||||||||| ||| |||||| ||||||||| | |||||||| ||| ||| ||| ||||| |||||||||||||||||| |
|
|
| T |
12635829 |
gattcccaggggaaacaacgcttggctagtgcgcatgcctctacgcacaagccggattagtcgcccactattggtgggtcggaaaccggtgcgaaagc |
12635926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 52 - 117
Target Start/End: Complemental strand, 14783483 - 14783418
Alignment:
| Q |
52 |
gcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||| |||||||||||| |||||||| |||| |||| ||| ||||| |||||||||||||||||| |
|
|
| T |
14783483 |
gcatgcctctacgcatgagccggattagtcgtccaccattggtgggtcggaaaccggtgcgaaagc |
14783418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 21 - 117
Target Start/End: Original strand, 13468949 - 13469045
Alignment:
| Q |
21 |
attcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||| || |||||||||| |||| |||| | |||| ||||||||| || || ||||| ||| |||| ||| |||||||||||||||||||||||| |
|
|
| T |
13468949 |
attcctagggggaacaacgattggtcagtgcacatgcctctacgcacgagccagattagtcgcccaccattggtgggttggaaaccggtgcgaaagc |
13469045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 32 - 117
Target Start/End: Complemental strand, 13584533 - 13584444
Alignment:
| Q |
32 |
gaacaacgcttggccagtacgcatgtctctacgcatgaa----ccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||| ||||||||| |||||| ||||| ||||| | ||||||||||||| |||||||| ||||| ||||||||| |||||||| |
|
|
| T |
13584533 |
gaacaacgtttggccagtgcgcatgcctctatgcatgcatgagccggattaatcgtccacctttggtgggtcggaaaccggcgcgaaagc |
13584444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 17114993 - 17114901
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgc |
111 |
Q |
| |
|
||||||| ||| ||||||||||||||||| | |||| |||||||||||| |||||||| ||| |||||||||| ||| ||||| |||||| |
|
|
| T |
17114993 |
cgattcctagaaggaacaacgcttggccaatggacatgcctctacgcatgagccggattagtcgcccacctttgataggtcggaaatcggtgc |
17114901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 30 - 117
Target Start/End: Complemental strand, 10311554 - 10311467
Alignment:
| Q |
30 |
gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| || ||||| ||| ||||| ||| ||||| | |||| ||||||||||| |
|
|
| T |
10311554 |
gggaacaacgcttggccagtgcgcatgtctctacgcacgagttagattagtcgctcaccattggtgggtcgaaaactggtgcgaaagc |
10311467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 29 - 100
Target Start/End: Complemental strand, 19230645 - 19230574
Alignment:
| Q |
29 |
agggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttg |
100 |
Q |
| |
|
|||||||||||||||| ||||| ||||| ||||||||| || |||||||| ||||||| | ||| ||||||| |
|
|
| T |
19230645 |
agggaacaacgcttggtcagtatgcatgcctctacgcacgagccggattagtcgttcatcattggtgggttg |
19230574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 5029831 - 5029929
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||| ||| | |||||||| |||| |||| |||||| |||||||||||| |||||| ||| || ||||||||||| |||||| ||||||||||| |
|
|
| T |
5029831 |
cgattctcagggagaacaacgtttggtcagtgcgcatgcctctacgcatgagttggattagtcgcccatctttgatgggtcggaaactggtgcgaaagc |
5029929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 53 - 115
Target Start/End: Complemental strand, 8149859 - 8149797
Alignment:
| Q |
53 |
catgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaa |
115 |
Q |
| |
|
|||| |||||||||| | ||| |||| |||| |||||||| |||||||||||||||||||||| |
|
|
| T |
8149859 |
catgcctctacgcattagccgaattagtcgtccacctttggtgggttggaaaccggtgcgaaa |
8149797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 14107454 - 14107356
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||| ||||||||||||| ||||| | |||| |||||||||||| |||||||| ||| || || ||||| |||||||||||||||||| |
|
|
| T |
14107454 |
cgattcccaggaggaacaacgcttgaccagtgcacatgcctctacgcatgagccggattagtcgcccattattagtgggtcggaaaccggtgcgaaagc |
14107356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 33 - 96
Target Start/End: Original strand, 8888910 - 8888973
Alignment:
| Q |
33 |
aacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgg |
96 |
Q |
| |
|
||||||| ||||||||| ||||| |||||||||||| ||||||| |||| |||||||||||| |
|
|
| T |
8888910 |
aacaacgtttggccagtgcgcatacctctacgcatgagtcggattagtcgtccacctttgatgg |
8888973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 30 - 109
Target Start/End: Original strand, 21945314 - 21945392
Alignment:
| Q |
30 |
gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggt |
109 |
Q |
| |
|
|||||||||||||||||||| || ||| ||||| |||||| ||||| ||||||| || ||| || |||||||||||||| |
|
|
| T |
21945314 |
gggaacaacgcttggccagttcgtatgcctctatgcatgagccggaataatcgtccattttttat-ggttggaaaccggt |
21945392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 21 - 116
Target Start/End: Complemental strand, 24671960 - 24671865
Alignment:
| Q |
21 |
attcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
|||||||||||||||||| |||| ||||| ||||| ||||||||| | |||||||| | || | |||||||||| | ||||| ||||| ||||| |
|
|
| T |
24671960 |
attcccagagggaacaacacttgaccagtgtgcatgcctctacgcacaagccggattagtagtccgcctttgatggttcggaaatcggtgtgaaag |
24671865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 72 - 117
Target Start/End: Complemental strand, 13116173 - 13116128
Alignment:
| Q |
72 |
cggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||||||||||| |||| ||||| |||||||||||||||||| |
|
|
| T |
13116173 |
cggattaatcgttcatttttggtgggtcggaaaccggtgcgaaagc |
13116128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 31 - 91
Target Start/End: Original strand, 5333030 - 5333090
Alignment:
| Q |
31 |
ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcaccttt |
91 |
Q |
| |
|
|||||||| |||| ||||| ||||||||||||| ||||| || ||||| ||||||| |||| |
|
|
| T |
5333030 |
ggaacaacacttgtccagtgcgcatgtctctacacatgagccagattagtcgttcatcttt |
5333090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 30 - 78
Target Start/End: Complemental strand, 9366508 - 9366460
Alignment:
| Q |
30 |
gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggatta |
78 |
Q |
| |
|
||||| |||||||||||||| |||||| ||||||||| || |||||||| |
|
|
| T |
9366508 |
gggaataacgcttggccagtgcgcatgcctctacgcacgagccggatta |
9366460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 115
Target Start/End: Original strand, 11142617 - 11142713
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaa |
115 |
Q |
| |
|
|||||| ||| || ||||||| ||| ||||| |||||| |||||||||||| | ||||| | || || ||||| ||||| ||| |||||||||||| |
|
|
| T |
11142617 |
cgattcgcagtggaaacaacgtttgaccagtgcgcatgcctctacgcatgagtcagattagttgtccaactttggtgggtcggagaccggtgcgaaa |
11142713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 53 - 117
Target Start/End: Original strand, 14326045 - 14326109
Alignment:
| Q |
53 |
catgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||| |||||||||||| |||||||| ||| ||| ||||| ||||| ||||| |||||| ||||| |
|
|
| T |
14326045 |
catgcctctacgcatgagccggattagtcgctcatctttggtgggtcggaaaacggtgcaaaagc |
14326109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 53 - 117
Target Start/End: Original strand, 14419055 - 14419119
Alignment:
| Q |
53 |
catgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||| |||||||||||| |||||||| ||| ||| ||||| ||||| ||||| |||||| ||||| |
|
|
| T |
14419055 |
catgcctctacgcatgagccggattagtcgctcatctttggtgggtcggaaaacggtgcaaaagc |
14419119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 63; Significance: 2e-27; HSPs: 56)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 1538442 - 1538540
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||| ||||||||| |||||||||| |||||| |||||||||||| ||||||||||||| |||| ||| ||||| |||||||||||||||||| |
|
|
| T |
1538442 |
cgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattaatcgtccaccattggtgggtcggaaaccggtgcgaaagc |
1538540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 9805015 - 9805113
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |||||| |||||||||||| |||||||| |||| |||||||| ||||| |||||| ||||||||||| |
|
|
| T |
9805015 |
cgattcccagggggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgtccacctttggtgggtcggaaacaggtgcgaaagc |
9805113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 40117426 - 40117524
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||| |||| |||||||||||||||||||| |||||| |||||||||||| |||||||||||||||||||||| ||| | | |||||||||||||||| |
|
|
| T |
40117426 |
cgatttccagggggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattaatcgttcacctttggtggatcgaaaaccggtgcgaaagc |
40117524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 42086338 - 42086436
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| |||||| |||||||||||| |||||||| |||| |||||||| ||||| |||||||||||||||||| |
|
|
| T |
42086338 |
cgattcccagggggaacaacgcttgaccagtgcgcatgcctctacgcatgagccggattagtcgtccacctttggtgggtcggaaaccggtgcgaaagc |
42086436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 20 - 117
Target Start/End: Original strand, 19572736 - 19572833
Alignment:
| Q |
20 |
gattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||||| ||||||||| |||||||||| |||||| |||||||||||| |||||||| ||||||||| ||| ||||||||||||| |||||||||| |
|
|
| T |
19572736 |
gattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgttcaccattggtgggttggaaaccagtgcgaaagc |
19572833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 20 - 117
Target Start/End: Complemental strand, 20682712 - 20682615
Alignment:
| Q |
20 |
gattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||| |||| |||||||||||||||||||| |||||| ||||||||| || |||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
20682712 |
gatttccagggggaacaacgcttggccagtgcgcatgcctctacgcacgagccggattaatcgaccacctttagtgggttggaaaccggtgcgaaagc |
20682615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 5732016 - 5731918
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |||||| ||||||| |||| || ||||| |||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
5732016 |
cgattcccaggaggaacaacgcttggccagtgcgcatgcctctacgtatgagccagattagtcgttcacctttagtgggtcggaaaccggtgcgaaagc |
5731918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 23383668 - 23383766
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||| |||||||||||||||||||| ||| || |||||||||||| | |||||| |||| |||||||| ||||| |||||| ||||||||||| |
|
|
| T |
23383668 |
cgattcccagggggaacaacgcttggccagtgcgcttgcctctacgcatgagctggattagtcgtccacctttggtgggtcggaaactggtgcgaaagc |
23383766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 30 - 117
Target Start/End: Original strand, 13664282 - 13664369
Alignment:
| Q |
30 |
gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||||| |||||||||| |||||| |||||||||||| || ||||||||| ||||||||| || || |||||||||||||||||| |
|
|
| T |
13664282 |
gggaacaacacttggccagtgcgcatgcctctacgcatgagccagattaatcgatcacctttggtgtgtcggaaaccggtgcgaaagc |
13664369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 34 - 117
Target Start/End: Original strand, 14728109 - 14728192
Alignment:
| Q |
34 |
acaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||||||| |||| |||||| |||||||||||| |||||||| | | ||||||||||||||| |||||||||||||||||| |
|
|
| T |
14728109 |
acaacgcttggtcagtgcgcatgcctctacgcatgagccggattagttgctcacctttgatgggtcggaaaccggtgcgaaagc |
14728192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 20 - 115
Target Start/End: Complemental strand, 42291600 - 42291505
Alignment:
| Q |
20 |
gattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaa |
115 |
Q |
| |
|
||||||||| | |||||||||||||||||| | |||| ||||||||| || |||||||| |||| |||||||||||| | |||||||||||||||| |
|
|
| T |
42291600 |
gattcccagggtgaacaacgcttggccagtgcacatgcctctacgcacgagccggattagtcgtccacctttgatggatcggaaaccggtgcgaaa |
42291505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 11845886 - 11845800
Alignment:
| Q |
30 |
gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
|||||||||| ||||||||| |||||| ||||||| |||| ||| |||||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
11845886 |
gggaacaacgtttggccagtgcgcatgcctctacgtatgagccgaattaatcgcccacctttgatgggttggaaaccggtgtgaaag |
11845800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 33 - 117
Target Start/End: Complemental strand, 42861300 - 42861216
Alignment:
| Q |
33 |
aacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||| |||||||||| |||||| |||||||||||| ||||||||||||| |||| ||| ||||| ||| |||||||||||||| |
|
|
| T |
42861300 |
aacaacacttggccagtgcgcatgcctctacgcatgagccggattaatcgtccaccattggtgggtcggagaccggtgcgaaagc |
42861216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 30 - 117
Target Start/End: Original strand, 41800999 - 41801086
Alignment:
| Q |
30 |
gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||||||| ||| | |||||||||||||||| || |||||||| ||||||| ||||||||||| ||||| ||||| |||||| |
|
|
| T |
41800999 |
gggaacaacgcttgaccaatgcgcatgtctctacgcacgagccggattagtcgttcatctttgatgggtcggaaagcggtgtgaaagc |
41801086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 31 - 117
Target Start/End: Original strand, 7866604 - 7866690
Alignment:
| Q |
31 |
ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||| ||||||||||| ||| |||||||| |||||| |||||| |||||||||| |
|
|
| T |
7866604 |
ggaacaacgcttggccagtgtgcatgcctctacgcacgaaccggattagtcgcccacctttggtgggttagaaaccagtgcgaaagc |
7866690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 31 - 117
Target Start/End: Original strand, 9812895 - 9812981
Alignment:
| Q |
31 |
ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||||||||| ||| |||||||| ||||| ||||||||||||||||| |
|
|
| T |
9812895 |
ggaacaacgcttggccagtgtgcatgcttctacgcatgaaccggattagtcgcccacctttggtgggtcagaaaccggtgcgaaagc |
9812981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 41163555 - 41163458
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||| |||||||||| ||||||||| | ||||||||||||||||| | |||||| |||| ||||||| ||||| |||||| ||||||||||| |
|
|
| T |
41163555 |
cgattcccag-gggaacaacgtttggccagtgcacatgtctctacgcatgagctggattagtcgtccaccttttgtgggtcggaaactggtgcgaaagc |
41163458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 19 - 96
Target Start/End: Complemental strand, 7308460 - 7308383
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgg |
96 |
Q |
| |
|
|||||||||| ||||||||||||||| |||| | |||| |||||||||||| |||||||| ||| ||||||||||||| |
|
|
| T |
7308460 |
cgattcccagggggaacaacgcttgggcagtgcacatgcctctacgcatgagccggattagtcgctcacctttgatgg |
7308383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 19 - 116
Target Start/End: Complemental strand, 25417279 - 25417182
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |||||| ||||||| | || |||||||| || || ||| ||| ||||| |||||||||||||||| |
|
|
| T |
25417279 |
cgattcccagggggaacaacgcttggccagtgcgcatgcctctacgaacgagccggattagtcatttaccattggtgggtcagaaaccggtgcgaaag |
25417182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 19 - 115
Target Start/End: Original strand, 20525849 - 20525945
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaa |
115 |
Q |
| |
|
|||||||||| |||||||| ||| |||||| |||||| |||||||||||| |||||||| |||| |||| ||| ||| | |||||||||||||||| |
|
|
| T |
20525849 |
cgattcccaggtggaacaacacttcgccagtgcgcatgcctctacgcatgagccggattagtcgtccaccattggtggatcggaaaccggtgcgaaa |
20525945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 32 - 104
Target Start/End: Original strand, 24875369 - 24875441
Alignment:
| Q |
32 |
gaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaa |
104 |
Q |
| |
|
|||||||| ||| ||||| |||||||||||||||| || ||||||||||||| |||||||||||||| ||||| |
|
|
| T |
24875369 |
gaacaacgtttgaccagtgcgcatgtctctacgcacgagccggattaatcgtccacctttgatgggtcggaaa |
24875441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 18 - 117
Target Start/End: Complemental strand, 9168349 - 9168251
Alignment:
| Q |
18 |
acgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| ||||| |||||||||||| |||||||| |||| ||||||| ||||| | ||| |||||| ||||| |
|
|
| T |
9168349 |
acgattcccagagg-aacaacgcttggccagtgcgcatacctctacgcatgagccggattagtcgtccacctttagtgggtcgaaaatcggtgcaaaagc |
9168251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 30 - 117
Target Start/End: Complemental strand, 39099864 - 39099777
Alignment:
| Q |
30 |
gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||||| |||||||||| | |||| |||||||||||| |||||||| ||| |||||||| ||||| |||||||||||| ||||| |
|
|
| T |
39099864 |
gggaacaacacttggccagtgcacatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcaaaagc |
39099777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 8513530 - 8513628
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||| || || ||||| ||||||||||| | |||| ||||||||| || || ||||| |||| |||||||| ||||| |||||||||||||||||| |
|
|
| T |
8513530 |
cgattcctaggggaaacaatgcttggccagtgcacatgcctctacgcacgagccagattagtcgtccacctttggtgggtcggaaaccggtgcgaaagc |
8513628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 31 - 117
Target Start/End: Original strand, 12705037 - 12705123
Alignment:
| Q |
31 |
ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||||||||| ||||| ||||| |||||||||||||||||||| ||| |||||||| ||||| ||||||||||||||||| |
|
|
| T |
12705037 |
ggaacaacgcttgaccagtgtgcatgcttctacgcatgaaccggattagtcgcccacctttggtgggtcagaaaccggtgcgaaagc |
12705123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 31 - 117
Target Start/End: Original strand, 12766154 - 12766240
Alignment:
| Q |
31 |
ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||| ||||||||||| ||||| ||||||||||||||| ||||| ||| |||||||| ||||| ||||||||||||||||| |
|
|
| T |
12766154 |
ggaacaatgcttggccagtgtgcatgcctctacgcatgaaccagattagtcgcccacctttggtgggtcagaaaccggtgcgaaagc |
12766240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 19 - 93
Target Start/End: Original strand, 26077152 - 26077226
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttga |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||| | |||| ||||||||| || || ||||||||| ||| |||||| |
|
|
| T |
26077152 |
cgattcccagagggaacaacgcttggccagtgcacatgcctctacgcacgagccagattaatcgctcatctttga |
26077226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 35 - 117
Target Start/End: Original strand, 27484188 - 27484270
Alignment:
| Q |
35 |
caacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||| |||| |||||| ||||| ||||||||||||||||||||| ||| || ||||||| ||||||||||||||| |||||| |
|
|
| T |
27484188 |
caacacttgaccagtatgcatgcctctacgcatgaaccggattagacgtccatctttgataggttggaaaccggtgtgaaagc |
27484270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 30 - 115
Target Start/End: Original strand, 37263262 - 37263347
Alignment:
| Q |
30 |
gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaa |
115 |
Q |
| |
|
|||||||||||||||||| | |||||| ||||||||| || |||||||| |||| ||||||| ||| | |||||||||||||||| |
|
|
| T |
37263262 |
gggaacaacgcttggccaatgcgcatgcctctacgcacgagccggattagtcgtccacctttattggatcggaaaccggtgcgaaa |
37263347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 20 - 116
Target Start/End: Original strand, 20692945 - 20693041
Alignment:
| Q |
20 |
gattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||| |||| |||| |||||| | ||||| | || |||||||| ||||| ||||||||||||||||| |
|
|
| T |
20692945 |
gattcctagaggaaacaacgcttggccagtacacatgcctctgtgcatgattcagattagttgtccacctttggtgggtcggaaaccggtgcgaaag |
20693041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 63 - 115
Target Start/End: Original strand, 40060339 - 40060391
Alignment:
| Q |
63 |
cgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaa |
115 |
Q |
| |
|
||||||| ||||||||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
40060339 |
cgcatgagccggattaatcgtccaccattgatgggttggaaaccggtgcgaaa |
40060391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 58 - 117
Target Start/End: Original strand, 28857196 - 28857255
Alignment:
| Q |
58 |
ctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||||| |||||||| ||| ||||||||| ||||| |||||||||||||||||| |
|
|
| T |
28857196 |
ctctacgcatgagccggattagtcgctcacctttggtgggtcggaaaccggtgcgaaagc |
28857255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 30 - 117
Target Start/End: Complemental strand, 38897804 - 38897717
Alignment:
| Q |
30 |
gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||||| || |||||||| | | |||||||| ||| | ||||||| |||||||||| |
|
|
| T |
38897804 |
gggaacaacgcttggccagtgcgcatgcctctacgcacgagccggattagttgcccacctttggtggatcggaaaccagtgcgaaagc |
38897717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 30 - 117
Target Start/End: Original strand, 43399150 - 43399237
Alignment:
| Q |
30 |
gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||| |||||||||||||| |||||| ||||||||| || | |||||| |||| ||| |||| | ||| |||||||||||||||||| |
|
|
| T |
43399150 |
gggaataacgcttggccagtgcgcatgcctctacgcacgagcaggattagtcgtccacatttggttggtcggaaaccggtgcgaaagc |
43399237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 2485218 - 2485304
Alignment:
| Q |
30 |
gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
||||||||| || |||| || |||||| ||||||| |||| ||||||| ||| ||||||||||||||| |||||||| |||||||| |
|
|
| T |
2485218 |
gggaacaaccctgggcctgtgcgcatgcctctacgtatgagtcggattagtcgctcacctttgatgggtcggaaaccgatgcgaaag |
2485304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 12081919 - 12082017
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||| ||| |||||||||||||||||||| |||||| |||||||| || ||| |||| |||| |||||||| || || ||||| ||||| |||||| |
|
|
| T |
12081919 |
cgattctcagggggaacaacgcttggccagtgcgcatgcatctacgcacgagccgaattagtcgtccacctttggtgagtcggaaatcggtgtgaaagc |
12082017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 23247447 - 23247350
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||| ||||||||||||| ||||| ||||| ||||||||| || || ||||| |||| |||||||||| ||| | |||||||||||||||| |
|
|
| T |
23247447 |
cgattcccaggaggaacaacgcttgatcagtatgcatgcctctacgcacgagccagattagtcgtccacctttgat-ggtcgaaaaccggtgcgaaagc |
23247350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 31 - 116
Target Start/End: Complemental strand, 14588701 - 14588616
Alignment:
| Q |
31 |
ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
|||| |||||||| ||||| |||||| |||||||||||| |||||||| |||| |||||||| || | | ||||||||||||||| |
|
|
| T |
14588701 |
ggaataacgcttgaccagtgcgcatgcctctacgcatgagccggattagtcgtccacctttggtgagccgaaaaccggtgcgaaag |
14588616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 32 - 117
Target Start/End: Original strand, 20255393 - 20255478
Alignment:
| Q |
32 |
gaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||| |||| ||||| |||||| |||||||||||| ||||||| |||| |||||||| || || |||||| ||||||||||| |
|
|
| T |
20255393 |
gaacaacacttgaccagtgcgcatgcctctacgcatgagtcggattagtcgtccacctttggtgagtcggaaactggtgcgaaagc |
20255478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 30 - 106
Target Start/End: Complemental strand, 18294569 - 18294493
Alignment:
| Q |
30 |
gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaacc |
106 |
Q |
| |
|
||||||||||||||| |||| ||||| |||||| |||||||||||||||||| || ||||| ||||| ||||||| |
|
|
| T |
18294569 |
gggaacaacgcttggtcagtgcgcatacctctacacatgaaccggattaatcgcccatctttggtgggtcggaaacc |
18294493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 61 - 117
Target Start/End: Original strand, 28857002 - 28857058
Alignment:
| Q |
61 |
tacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||||| |||||||| ||| ||||||||| ||||| |||||||||||||||||| |
|
|
| T |
28857002 |
tacgcatgagccggattagtcgctcacctttggtgggtcggaaaccggtgcgaaagc |
28857058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 19 - 74
Target Start/End: Original strand, 28857139 - 28857194
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccgg |
74 |
Q |
| |
|
|||||||||| ||||||||| |||||||||| |||||| |||||||||||| |||| |
|
|
| T |
28857139 |
cgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccgg |
28857194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 30 - 117
Target Start/End: Original strand, 38369721 - 38369808
Alignment:
| Q |
30 |
gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||||| |||||||||| |||||| ||||||||| || ||||||| | ||||||||||||||| |||| |||||||||||| |
|
|
| T |
38369721 |
gggaacaacacttggccagtgcgcatgcctctacgcacgagtcggattagtaacccacctttgatgggttagaaatcggtgcgaaagc |
38369808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 14152061 - 14152159
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||| || ||||||||||||||||||||| ||||| |||| ||||| ||||||||||||| |||| ||||||| | | ||||| ||||||||| |
|
|
| T |
14152061 |
cgattctcatagggaacaacgcttggccagtgtgcatgcttctatccatgagccggattaatcgtccaccattgatggatcgaaaacctatgcgaaagc |
14152159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 32 - 117
Target Start/End: Complemental strand, 3653997 - 3653912
Alignment:
| Q |
32 |
gaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||||| ||||| |||||| ||||||||| || ||||||| |||| |||||||| ||| | | |||||||||| ||||| |
|
|
| T |
3653997 |
gaacaacgcttgaccagtgcgcatgcctctacgcacgaggcggattagtcgtccacctttggtggatcgaaaaccggtgcaaaagc |
3653912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 18136376 - 18136274
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaat----cgttcacctttgatgggttggaaaccggtgcgaa |
114 |
Q |
| |
|
|||||||||| ||||||||| ||||| |||| ||||| |||||| ||||| |||||||||| ||| |||| ||| ||||| |||||||||||| || |
|
|
| T |
18136376 |
cgattcccagggggaacaacacttggtcagtgtgcatgcctctacacatgagccggattaattagtcgtccaccattggtgggtcggaaaccggtgcaaa |
18136277 |
T |
 |
| Q |
115 |
agc |
117 |
Q |
| |
|
||| |
|
|
| T |
18136276 |
agc |
18136274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 30 - 78
Target Start/End: Original strand, 20590021 - 20590069
Alignment:
| Q |
30 |
gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggatta |
78 |
Q |
| |
|
|||||||||||||||||||| |||||| |||||||||||| ||| |||| |
|
|
| T |
20590021 |
gggaacaacgcttggccagtgcgcatgactctacgcatgagccgtatta |
20590069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 29 - 117
Target Start/End: Original strand, 21375372 - 21375460
Alignment:
| Q |
29 |
agggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||| ||| ||||| |||||| ||||||||||| ||||||| |||| || ||||||||| | ||||||| |||||||||| |
|
|
| T |
21375372 |
agggaacaacatttgaccagtgcgcatgcttctacgcatgagtcggattagtcgtccatctttgatggatcggaaaccagtgcgaaagc |
21375460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 61 - 117
Target Start/End: Original strand, 36783296 - 36783352
Alignment:
| Q |
61 |
tacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||||| |||||||| |||| |||| ||| |||||||||||||||||| ||||| |
|
|
| T |
36783296 |
tacgcatgagccggattagtcgtccaccattggtgggttggaaaccggtgcaaaagc |
36783352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 30 - 117
Target Start/End: Original strand, 30349601 - 30349688
Alignment:
| Q |
30 |
gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||| | ||||||||| |||||| ||||| |||||| | | |||| |||| |||||| | |||| |||||||||||||||||| |
|
|
| T |
30349601 |
gggaacaatgattggccagtgcgcatgcctctatgcatgagctgaattagtcgtccaccttaggtgggccggaaaccggtgcgaaagc |
30349688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 30 - 92
Target Start/End: Complemental strand, 14974409 - 14974347
Alignment:
| Q |
30 |
gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttg |
92 |
Q |
| |
|
||||||||| ||||||||| | |||| |||||||||||| |||||||| |||| |||||||| |
|
|
| T |
14974409 |
gggaacaacatttggccagtgcacatgcctctacgcatgagccggattagtcgtccacctttg |
14974347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 19 - 56
Target Start/End: Original strand, 1899012 - 1899049
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatg |
56 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
1899012 |
cgattcccagggggaacaacgcttggccagtgcgcatg |
1899049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 36 - 117
Target Start/End: Original strand, 24499010 - 24499091
Alignment:
| Q |
36 |
aacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||| |||| |||||| ||||||| | || |||||||||| || || ||||| ||||||||||| ||||||||||| |
|
|
| T |
24499010 |
aacgcttgatcagtgcgcatgcctctacgtacgagccggattaatagtccatctttggtgggttggaaattggtgcgaaagc |
24499091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 32 - 117
Target Start/End: Complemental strand, 24653894 - 24653810
Alignment:
| Q |
32 |
gaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||| ||||| |||| ||||| |||||||||| | ||||||||||||| |||| ||| ||||| | |||||| ||||||||| |
|
|
| T |
24653894 |
gaacaacacttggtcagtgcgcatacctctacgcat-agccggattaatcgtccaccattggtgggtcgaaaaccgatgcgaaagc |
24653810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 31 - 80
Target Start/End: Original strand, 25467433 - 25467482
Alignment:
| Q |
31 |
ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaat |
80 |
Q |
| |
|
||||||||| |||||||||||||||| ||||||||| || | |||||||| |
|
|
| T |
25467433 |
ggaacaacgattggccagtacgcatgcctctacgcacgagctggattaat |
25467482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 30 - 66
Target Start/End: Complemental strand, 35403597 - 35403561
Alignment:
| Q |
30 |
gggaacaacgcttggccagtacgcatgtctctacgca |
66 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||||| |
|
|
| T |
35403597 |
gggaacaacgcttggccaatgcgcatgtctctacgca |
35403561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 62; Significance: 7e-27; HSPs: 53)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 19 - 116
Target Start/End: Complemental strand, 38578963 - 38578866
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |||||| |||||||||||| |||||||| ||| |||||||| ||||| ||||||||||||||||| |
|
|
| T |
38578963 |
cgattcccagggggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag |
38578866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 21 - 117
Target Start/End: Original strand, 13095873 - 13095969
Alignment:
| Q |
21 |
attcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||| ||||||||| |||||||||| |||||| |||||||||||| |||||||| ||| ||||||||| ||||| |||||||||||| ||||| |
|
|
| T |
13095873 |
attcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgctcacctttggtgggtcggaaaccggtgcaaaagc |
13095969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 19 - 114
Target Start/End: Original strand, 18785682 - 18785777
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaa |
114 |
Q |
| |
|
||||||| || ||||||||| |||||||||| |||||| |||||||||||||| |||||| |||||||||| || ||||| ||||||||||||||| |
|
|
| T |
18785682 |
cgattcctagggggaacaacacttggccagtgcgcatgcctctacgcatgaactggattagtcgttcacctctggtgggtcggaaaccggtgcgaa |
18785777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 17748478 - 17748380
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |||||| ||||||| | || |||||||| |||| |||||||| ||||| |||||||| ||||||||| |
|
|
| T |
17748478 |
cgattcccagggggaacaacgcttggccagtgcgcatgcctctacgtacgagccggattagtcgtccacctttgttgggtcggaaaccgatgcgaaagc |
17748380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 43862068 - 43861970
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||| |||||||||| ||||||||| |||||| |||||||||||| |||||||| || |||||||||| ||| | | |||||||||||||||| |
|
|
| T |
43862068 |
cgattcccagggggaacaacgtttggccagtgcgcatgcctctacgcatgagccggattagtcattcacctttggtggatcgaaaaccggtgcgaaagc |
43861970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 48804696 - 48804794
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||||| ||||||||| |||||||||| |||||| |||||||||||| |||||||| |||| |||| ||| ||||| |||||||||||||||||| |
|
|
| T |
48804696 |
cgattcccaaggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgtccaccattggtgggtcggaaaccggtgcgaaagc |
48804794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 31 - 117
Target Start/End: Complemental strand, 22993451 - 22993365
Alignment:
| Q |
31 |
ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||| ||||||||||| ||| ||||||||| ||||| ||||||||||||||||| |
|
|
| T |
22993451 |
ggaacaacgcttggccagtgtgcatgcctctacgcacgaaccggattagtcgctcacctttggtgggtcagaaaccggtgcgaaagc |
22993365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 23 - 117
Target Start/End: Original strand, 39420854 - 39420948
Alignment:
| Q |
23 |
tcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||| ||||||||||||||||||||| ||| || |||||||||||| |||||||| |||| |||||||||||| |||||||||||| ||||| |
|
|
| T |
39420854 |
tcccaaagggaacaacgcttggccagtgcgcgtgcctctacgcatgagccggattagtcgtctacctttgatgggccggaaaccggtgcaaaagc |
39420948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 19 - 116
Target Start/End: Original strand, 27028292 - 27028389
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
||||| |||| ||||||||| |||||||||| |||||| |||||| ||||| | |||||| ||| ||||||||| ||||| ||||||||||||||||| |
|
|
| T |
27028292 |
cgatttccagggggaacaacacttggccagtgcgcatgcctctacacatgagctggattagtcgctcacctttggtgggtcggaaaccggtgcgaaag |
27028389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 1797473 - 1797571
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||| || ||||||||||||||||| |||||||||||||||| || ||||| || |||| || ||||||||| | | |||||||||| ||||| |
|
|
| T |
1797473 |
cgattcccaggggaaacaacgcttggccagtgcgcatgtctctacgcacgagccggactagtcgtccatctttgatggatcgaaaaccggtgcaaaagc |
1797571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 10047972 - 10047874
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||| ||||||||| |||||||||| |||| | |||||||||||| | | |||| |||| |||| ||| ||||| |||||||||||||||||| |
|
|
| T |
10047972 |
cgattcccagggggaacaacacttggccagtgcgcaggcctctacgcatgagcagaattagtcgtccaccattggtgggtcggaaaccggtgcgaaagc |
10047874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 37514945 - 37515031
Alignment:
| Q |
30 |
gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
|||||||||| |||| |||| |||||||||||||||| || |||||||||||||||||| || ||||| ||||||||||| ||||| |
|
|
| T |
37514945 |
gggaacaacgtttggtcagtgcgcatgtctctacgcacgagccggattaatcgttcaccattagtgggtcggaaaccggtgtgaaag |
37515031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 47341889 - 47341987
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||| ||||||||| |||||||||| |||||| ||||||||| || | ||||| ||||||||| ||| ||||| ||||| |||||||||||| |
|
|
| T |
47341889 |
cgattcccagggggaacaacacttggccagtgcgcatgcctctacgcacgagcaggattggtcgttcaccattggtgggtcggaaatcggtgcgaaagc |
47341987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 32 - 117
Target Start/End: Original strand, 48551883 - 48551968
Alignment:
| Q |
32 |
gaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||| ||||||| | |||||| ||||||| |||| |||||||| |||| |||||||||||| | |||||||||||||||||| |
|
|
| T |
48551883 |
gaacaacggttggccaatgcgcatgcctctacgtatgagccggattagtcgtccacctttgatggatcggaaaccggtgcgaaagc |
48551968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 31 - 107
Target Start/End: Complemental strand, 19914787 - 19914711
Alignment:
| Q |
31 |
ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccg |
107 |
Q |
| |
|
||||||||||||||||| | |||||| |||||||||||| || ||||||||| |||||||||||||||| |||||| |
|
|
| T |
19914787 |
ggaacaacgcttggccaatgcgcatgcctctacgcatgagccagattaatcgcccacctttgatgggttgtaaaccg |
19914711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 29 - 116
Target Start/End: Original strand, 41945496 - 41945583
Alignment:
| Q |
29 |
agggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
|||||| |||||||||||||| |||||| ||||||||| || |||||||| |||| |||||||| || || ||||| ||||||||||| |
|
|
| T |
41945496 |
agggaataacgcttggccagtgcgcatgcctctacgcacgagccggattagtcgtccacctttggtgagtcggaaatcggtgcgaaag |
41945583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 1605954 - 1606052
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||| |||| |||||||||||||||||||| | |||| ||||| || ||| |||||||| ||| |||||||| ||| | |||||||||||||||||| |
|
|
| T |
1605954 |
cgatttccagggggaacaacgcttggccagtgcacatgcctctaggcttgagccggattagtcgcccacctttggtggatcggaaaccggtgcgaaagc |
1606052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 22573836 - 22573922
Alignment:
| Q |
30 |
gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
||||||||| ||| ||||| |||||| || ||||||||| ||||||||||||| || | ||||||||||| ||||||||||||||| |
|
|
| T |
22573836 |
gggaacaacatttgaccagtgcgcatgcctttacgcatgagccggattaatcgtccatcattgatgggttgaaaaccggtgcgaaag |
22573922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 22973980 - 22974078
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||| ||| |||||||||||||||||||| ||||| ||||||||||| || ||||| |||| |||||||| ||||| |||||||| |||||||| |
|
|
| T |
22973980 |
cgattctcagggggaacaacgcttggccagtgtgcatgcgtctacgcatgagccagattagtcgtccacctttggtgggtcagaaaccggcgcgaaagc |
22974078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 19 - 115
Target Start/End: Complemental strand, 26423383 - 26423288
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaa |
115 |
Q |
| |
|
|||||||||| || ||||||||||||||||| | | || ||||||||| || || ||||| ||||||||||||| | ||| |||||||||||||||| |
|
|
| T |
26423383 |
cgattcccaggggaaacaacgcttggccagtgcacctgcctctacgcacgagccagattagtcgttcacctttggt-ggtcggaaaccggtgcgaaa |
26423288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 41 - 116
Target Start/End: Original strand, 3353459 - 3353534
Alignment:
| Q |
41 |
ttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
||||||||| |||||| ||||||||| || |||||||| |||| |||||||||||| | |||||||||||||||| |
|
|
| T |
3353459 |
ttggccagtgcgcatgcctctacgcacgagccggattagtcgtccacctttgatggatcagaaaccggtgcgaaag |
3353534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 30 - 117
Target Start/End: Original strand, 28744186 - 28744273
Alignment:
| Q |
30 |
gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||| ||||||||||||||||| |||||| | || |||||||| |||| |||||||| ||||| |||||| ||||||||||| |
|
|
| T |
28744186 |
gggaacaatgcttggccagtacgcatacctctacatacgagccggattagtcgtccacctttggtgggtcggaaactggtgcgaaagc |
28744273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 30 - 117
Target Start/End: Original strand, 39474964 - 39475051
Alignment:
| Q |
30 |
gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||||||||||| |||| ||||| |||||||||||| |||||||| |||| ||||||| ||||| | ||||| |||||||||| |
|
|
| T |
39474964 |
gggaacaacgcttggtcagtgcgcatacctctacgcatgagccggattagtcgtccacctttagtgggtcgaaaaccagtgcgaaagc |
39475051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 20 - 111
Target Start/End: Complemental strand, 45960098 - 45960007
Alignment:
| Q |
20 |
gattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgc |
111 |
Q |
| |
|
|||||||| || |||||| ||||| |||| |||||| |||||||||| | |||||||| ||| ||||||||||||| | |||||||||||| |
|
|
| T |
45960098 |
gattcccaagggcaacaacacttggtcagtgcgcatgcctctacgcataagccggattagtcgctcacctttgatggatcggaaaccggtgc |
45960007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 46 - 116
Target Start/End: Original strand, 3603397 - 3603467
Alignment:
| Q |
46 |
cagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
|||| |||||| ||||||||| || ||||||||||||||||| |||| ||||| ||||| ||||||||||| |
|
|
| T |
3603397 |
cagtgcgcatgcctctacgcacgagccggattaatcgttcacttttggtgggtcggaaatcggtgcgaaag |
3603467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 31 - 117
Target Start/End: Complemental strand, 4195286 - 4195200
Alignment:
| Q |
31 |
ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||| ||||| ||| |||||| |||||||||||| |||||||| ||| |||| ||| |||||||||||||| ||||||||| |
|
|
| T |
4195286 |
ggaacaacatttggctagtgcgcatgcctctacgcatgagccggattagccgtccaccattggtgggttggaaaccgatgcgaaagc |
4195200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 134 - 200
Target Start/End: Complemental strand, 6454043 - 6453977
Alignment:
| Q |
134 |
gtcttaagcccaaactaaagcatcacagataaatggtgcatataattacatgtgtcacttagctcat |
200 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||| | ||||||||||||||||| || ||||| |
|
|
| T |
6454043 |
gtcttaagccaaaactaaagcatctcagataaatggtagaaataattacatgtgtcacataactcat |
6453977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 31 - 117
Target Start/End: Original strand, 14650342 - 14650428
Alignment:
| Q |
31 |
ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||| ||||| ||||| | ||| |||||||||||| |||| ||| ||| ||||||||| ||||||| |||||||||||||||| |
|
|
| T |
14650342 |
ggaacaatgcttgaccagtgcatatgcctctacgcatgagccgggttagtcgctcacctttggtgggttgaaaaccggtgcgaaagc |
14650428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 29151953 - 29152051
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||| |||||||| ||| ||||| |||||| |||||| || || ||||||||||||| ||| ||||||||| |||||||| ||||||||| |
|
|
| T |
29151953 |
cgattcccaggaagaacaacgtttgaccagtgcgcatgcctctacacacgatccggattaatcgtctaccattgatgggtcggaaaccgatgcgaaagc |
29152051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 42210358 - 42210260
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||| | ||||||| ||||||||| |||||| ||||||||| || ||||||||||| |||| ||| ||||| |||||||| ||||||||| |
|
|
| T |
42210358 |
cgattcccagtgaaaacaacgtttggccagtgcgcatgcctctacgcacgagccggattaatcacccaccgttggtgggtcggaaaccgatgcgaaagc |
42210260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 43925525 - 43925623
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||| ||||||||| ||||| |||| |||||| |||||||||||| | |||||| | ||| ||||||||||| | ||||||| || |||||| |
|
|
| T |
43925525 |
cgattcccagggggaacaacacttggtcagtgcgcatgcctctacgcatgagctggattagttgtttacctttgatggatcagaaaccgatgtgaaagc |
43925623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 29 - 117
Target Start/End: Complemental strand, 24969412 - 24969324
Alignment:
| Q |
29 |
agggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||| |||||||||| ||| || ||||||| | | ||||||||||| ||| ||||||||| | |||||||||||||||||| |
|
|
| T |
24969412 |
agggaacaacacttggccagtgcgcgtgcctctacgtacaagtcggattaatcgctcatctttgatggctcggaaaccggtgcgaaagc |
24969324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 19 - 115
Target Start/End: Complemental strand, 27875184 - 27875088
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaa |
115 |
Q |
| |
|
|||||||||| ||||| ||| |||||||||| | |||| |||||||||||| || |||| |||| ||||||| ||||| | |||||||||||||| |
|
|
| T |
27875184 |
cgattcccagggggaataacacttggccagtgcacatgcctctacgcatgagtcgcattagtcgtccacctttagtgggtcgaaaaccggtgcgaaa |
27875088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 30 - 117
Target Start/End: Complemental strand, 8734771 - 8734684
Alignment:
| Q |
30 |
gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||| |||||| |||| |||||| ||| ||||| || || ||||| ||| |||||||| ||||| |||||||||||||||||| |
|
|
| T |
8734771 |
gggaacaatgcttgggcagtgcgcatgcctcaacgcacgagccagattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc |
8734684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 30 - 117
Target Start/End: Original strand, 34659250 - 34659337
Alignment:
| Q |
30 |
gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||||||| ||||| |||||| ||||||||| || |||||||| ||| |||| ||| || || | |||||||||||||||| |
|
|
| T |
34659250 |
gggaacaacgcttgaccagtgcgcatgcctctacgcacgagccggattagtcgcccaccattggtgtgtcgaaaaccggtgcgaaagc |
34659337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 19 - 98
Target Start/End: Complemental strand, 36619350 - 36619271
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggt |
98 |
Q |
| |
|
|||||||||| ||||||||| |||| ||||| ||||| |||||||||||| |||||||| |||| |||| ||| ||||| |
|
|
| T |
36619350 |
cgattcccagggggaacaacacttgtccagtgtgcatgcctctacgcatgagccggattagtcgtccaccattggtgggt |
36619271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 20247255 - 20247169
Alignment:
| Q |
30 |
gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
||||||||||||||| |||||| |||||||||||| | | ||||||| |||| |||| ||||| ||||||||||| || |||||| |
|
|
| T |
20247255 |
gggaacaacgcttgggcagtacacatgtctctacgtacgggtcggattagtcgtccaccattgataggttggaaaccagtacgaaag |
20247169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 23658192 - 23658290
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||| |||| |||||||||||||||||||| ||||| |||||| || || |||||||| |||| || ||||| ||||| |||||| |||| ||||| |
|
|
| T |
23658192 |
cgatttccagggggaacaacgcttggccagtgtgcatgcctctacacacgagccggattagtcgtccatctttggtgggtcagaaacctgtgcaaaagc |
23658290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 29805525 - 29805439
Alignment:
| Q |
30 |
gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
|||||||||| |||| |||| ||||||||||||||||||| || ||||||||| |||||| || || ||||||| ||||||||| |
|
|
| T |
29805525 |
gggaacaacgtttggtcagtgcgcatgtctctacgcatgagccaaattaatcgtctacctttagtgagtcggaaaccagtgcgaaag |
29805439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 32823256 - 32823354
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||| ||||||||| ||||||| || | ||| ||||||||| || |||||||| ||| ||| ||||||||| |||||| ||||||||||| |
|
|
| T |
32823256 |
cgattcccagggggaacaacacttggccggtgtgtatgcctctacgcacgagccggattagtcgcagaccattgatgggtcggaaacgggtgcgaaagc |
32823354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 42032109 - 42032207
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||||| |||||||||| ||||||||| | ||| ||||||||||| ||| |||| | || |||||||||||||| |||||||| ||| ||||| |
|
|
| T |
42032109 |
cgattcccacggggaacaacgtttggccagtgcacatacatctacgcatgagccgaattagttgtccacctttgatgggtcggaaaccgatgctaaagc |
42032207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 49142765 - 49142667
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||| || ||||||||||||| |||||| | |||| ||||||||| || |||||||| | | |||||||||||||| | ||| ||||||||||| |
|
|
| T |
49142765 |
cgattcctagggggaacaacgcttagccagtgcacatgcctctacgcacgagccggattagttgcccacctttgatgggtcgaaaattggtgcgaaagc |
49142667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 32 - 93
Target Start/End: Original strand, 30827318 - 30827379
Alignment:
| Q |
32 |
gaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttga |
93 |
Q |
| |
|
||||||| ||||||||||||||||| ||||||||| || |||||||| |||| |||||||| |
|
|
| T |
30827318 |
gaacaacacttggccagtacgcatgcctctacgcacgagccggattagtcgtctacctttga |
30827379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 21 - 109
Target Start/End: Complemental strand, 28396254 - 28396166
Alignment:
| Q |
21 |
attcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggt |
109 |
Q |
| |
|
|||| ||| ||||||||||||| || || |||||| || ||||||||| |||||||| |||| ||||||| ||||| |||||||||| |
|
|
| T |
28396254 |
attctcagggggaacaacgcttagctggtgcgcatgcctttacgcatgagccggattagtcgtctacctttggtgggtcggaaaccggt |
28396166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 51 - 117
Target Start/End: Complemental strand, 24983483 - 24983416
Alignment:
| Q |
51 |
cgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggt-tggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||| |||||||||||| |||||||| |||| |||| ||| ||||| ||||||||| ||||||||| |
|
|
| T |
24983483 |
cgcatgcctctacgcatgagccggattagtcgtccaccattggtgggtctggaaaccgatgcgaaagc |
24983416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 58 - 117
Target Start/End: Complemental strand, 48244413 - 48244354
Alignment:
| Q |
58 |
ctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||||| |||||||| ||| ||||||||| ||| | | |||||||||||||||| |
|
|
| T |
48244413 |
ctctacgcatgagccggattagtcgctcacctttggtggatcgaaaaccggtgcgaaagc |
48244354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 31 - 117
Target Start/End: Complemental strand, 5069899 - 5069813
Alignment:
| Q |
31 |
ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||||| || ||| ||||| ||||||||| | |||||||| ||| |||||||| ||||| |||||||| ||||||||| |
|
|
| T |
5069899 |
ggaacaacgcttagctagtgtgcatgcctctacgcacaagccggattagtcgcccacctttggtgggtcggaaaccgatgcgaaagc |
5069813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 10317841 - 10317744
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||| ||||| ||| ||||| |||| || ||| ||||| |||| || | ||||| ||| ||||||||| ||| | |||||||||||||||||| |
|
|
| T |
10317841 |
cgattcccagggggaataacacttggtcagtgcgtatgcctctatgcat-aagcagattagtcgctcacctttggtggatcggaaaccggtgcgaaagc |
10317744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 40 - 113
Target Start/End: Original strand, 38988934 - 38989006
Alignment:
| Q |
40 |
cttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcga |
113 |
Q |
| |
|
||||| |||| | |||| ||||||||||||||||||||| ||| ||| ||||| |||| | ||||||||||||| |
|
|
| T |
38988934 |
cttggtcagtgcacatgcctctacgcatgaaccggattagtcgctcatctttggtggg-tcgaaaccggtgcga |
38989006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 31 - 111
Target Start/End: Complemental strand, 5039502 - 5039422
Alignment:
| Q |
31 |
ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgc |
111 |
Q |
| |
|
|||||||| ||||| |||| | ||| |||||||||||| |||||||| ||| ||||||||| ||| | | |||||||||| |
|
|
| T |
5039502 |
ggaacaacacttggtcagtgcacatacctctacgcatgagccggattagtcgctcacctttggtggatcgaaaaccggtgc |
5039422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 135 - 191
Target Start/End: Complemental strand, 6464780 - 6464724
Alignment:
| Q |
135 |
tcttaagcccaaactaaagcatcacagataaatggtgcatataattacatgtgtcac |
191 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||| | |||||| |||||||||| |
|
|
| T |
6464780 |
tcttaagccaaaactaaagcatctaagataaatggtagagataattccatgtgtcac |
6464724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 53 - 117
Target Start/End: Original strand, 32768984 - 32769048
Alignment:
| Q |
53 |
catgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||| ||||||||| || ||||||| ||||||||||||| ||| | ||||||||||| |||||| |
|
|
| T |
32768984 |
catgcctctacgcacgagtcggattagtcgttcacctttggtggatcggaaaccggtgtgaaagc |
32769048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 132 - 200
Target Start/End: Complemental strand, 44943133 - 44943065
Alignment:
| Q |
132 |
tggtcttaagcccaaactaaagcatcacagataaatggtgcatataattacatgtgtcacttagctcat |
200 |
Q |
| |
|
|||||||||||| |||| |||||||| || ||||||| | | |||||||||||||||| |||| |||| |
|
|
| T |
44943133 |
tggtcttaagccgaaaccaaagcatctcatataaatgaagtaaataattacatgtgtcatttaggtcat |
44943065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 60; Significance: 1e-25; HSPs: 52)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 20 - 111
Target Start/End: Original strand, 10669603 - 10669694
Alignment:
| Q |
20 |
gattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgc |
111 |
Q |
| |
|
||||||||| | |||||||||||||||||| |||||||||||||||| || ||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
10669603 |
gattcccagggagaacaacgcttggccagtgcgcatgtctctacgcacgagtcggattaatcgttcacctttggtgggtcggaaaccggtgc |
10669694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 25540500 - 25540402
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||| || |||||||||||||||||||| |||||| ||||||||| || |||||||| |||| |||||||| ||||| |||||||||||||||||| |
|
|
| T |
25540500 |
cgattcctagggggaacaacgcttggccagtgcgcatgcctctacgcacgagccggattagtcgtccacctttggtgggtcggaaaccggtgcgaaagc |
25540402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 41220645 - 41220743
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |||||| |||||||||||| ||| |||| |||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
41220645 |
cgattcccaggaggaacaacgcttggccagtgcgcatgcctctacgcatgagccgaattagtcgttcacctttagtgggtcggaaaccggtgcgaaagc |
41220743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 31 - 116
Target Start/End: Original strand, 38962785 - 38962870
Alignment:
| Q |
31 |
ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||||||||||||||| |||| |||||||| ||||| ||||| |||||||||| |
|
|
| T |
38962785 |
ggaacaacgcttggccagtgcgcatgcctctacgcatgaaccggattagtcgtccacctttggtgggtcagaaactggtgcgaaag |
38962870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 19 - 98
Target Start/End: Complemental strand, 45263763 - 45263684
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggt |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| ||||||||| || |||||||||||| ||| ||||| ||||| |
|
|
| T |
45263763 |
cgattcccagagggaacaacgcttggccagtgcgcatgcctctacgcacgagccggattaatcgctcatctttggtgggt |
45263684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 31 - 117
Target Start/End: Original strand, 7747296 - 7747382
Alignment:
| Q |
31 |
ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||||| ||||||||| ||||| |||||||||||| |||||||| |||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
7747296 |
ggaacaacgtttggccagtgtgcatgcctctacgcatgagccggattagtcgttcacctttagtgggtcggaaaccggtgcgaaagc |
7747382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 16325605 - 16325703
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||| ||||||||| |||||||||| ||||| |||||||||||| || ||||| |||| |||| ||| ||||| |||||||||||||||||| |
|
|
| T |
16325605 |
cgattcccagggggaacaacacttggccagtgtgcatgcctctacgcatgagccagattagtcgtccaccattggtgggtcggaaaccggtgcgaaagc |
16325703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 31 - 117
Target Start/End: Complemental strand, 20116696 - 20116610
Alignment:
| Q |
31 |
ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||| |||||| | |||||| |||||||||||| |||||||| ||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
20116696 |
ggaacaacgcatggccaatgcgcatgcctctacgcatgagccggattagccgtccacctttgatgggtcggaaaccggtgcgaaagc |
20116610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 22593145 - 22593241
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||| |||||||||| ||||||||| |||||| |||||||||||| |||||||| |||| |||||||| ||||| || ||||||||||||||| |
|
|
| T |
22593145 |
cgattcccagggggaacaacg-ttggccagtgcgcatgcctctacgcatgagccggattagtcgtccacctttggtgggtcgg-aaccggtgcgaaagc |
22593241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 19 - 116
Target Start/End: Original strand, 2550878 - 2550975
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
|||||||||| |||||||| ||| |||||| ||||||||||||||||||| |||||||| ||| ||| |||| ||||||| ||||||||||||||| |
|
|
| T |
2550878 |
cgattcccaggaggaacaacacttagccagtgcgcatgtctctacgcatgagccggattagtcgcccacttttggtgggttgaaaaccggtgcgaaag |
2550975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 20 - 117
Target Start/End: Original strand, 10823071 - 10823168
Alignment:
| Q |
20 |
gattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||||| ||||||||||||||||||| |||||| ||||||||| || |||||||| ||| ||||||| ||||| |||||||||||||||||| |
|
|
| T |
10823071 |
gattcccaggaggaacaacgcttggccagtgcgcatgcctctacgcacgagccggattagtcgcccaccttttgtgggtcggaaaccggtgcgaaagc |
10823168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 19 - 106
Target Start/End: Original strand, 331511 - 331598
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaacc |
106 |
Q |
| |
|
|||||||||| ||||||||| |||||||||| |||||| ||||||||||| |||||||| ||| |||||||| ||||||||||||| |
|
|
| T |
331511 |
cgattcccagggggaacaacacttggccagtgcgcatgcttctacgcatgagccggattagtcgcccacctttggtgggttggaaacc |
331598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 30 - 117
Target Start/End: Complemental strand, 34346372 - 34346285
Alignment:
| Q |
30 |
gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||||| |||||||||| ||||| |||||||||||| | ||||||||| ||||||||| ||||| |||||||||||||||||| |
|
|
| T |
34346372 |
gggaacaacacttggccagtgtgcatgcctctacgcatgagtcagattaatcgctcacctttggtgggtcggaaaccggtgcgaaagc |
34346285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 30 - 117
Target Start/End: Original strand, 37560194 - 37560281
Alignment:
| Q |
30 |
gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||| |||| |||| |||||| ||||||||| || ||||||||||||| |||||||||||||| | ||||||||| |||||| |
|
|
| T |
37560194 |
gggaacaacgtttggtcagtgcgcatgcctctacgcacgagccggattaatcgtccacctttgatgggtcgaaaaccggtgtgaaagc |
37560281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 19 - 110
Target Start/End: Complemental strand, 39201604 - 39201513
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtg |
110 |
Q |
| |
|
|||||| ||| |||||||| | ||||||||| ||||| |||||||||||| |||||||| ||||||||||||| ||||| ||||||||||| |
|
|
| T |
39201604 |
cgattctcagggggaacaatgtttggccagtgtgcatgcctctacgcatgagccggattagtcgttcacctttggtgggtcggaaaccggtg |
39201513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 31 - 117
Target Start/End: Complemental strand, 3643971 - 3643885
Alignment:
| Q |
31 |
ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||||||| | |||||| |||| |||||||| |||| |||||||| ||||||||| |
|
|
| T |
3643971 |
ggaacaacgcttggccagtgcgcatgcctctacgcatgagctggattagtcgtccacctttggtgggccggaaaccgttgcgaaagc |
3643885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 3811787 - 3811689
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||||||||||||| ||||| || | |||||| |||||||||||| |||||||| ||| |||||||| ||||| ||||||| ||||||||| |
|
|
| T |
3811787 |
cgattcccagagggaacaacacttggtcaatgcgcatgcctctacgcatgagccggattactcgcccacctttggtgggtcagaaaccgatgcgaaagc |
3811689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 5035298 - 5035396
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||||||| ||||| ||||| ||||| |||||||||||||||| |||||||||||||| | ||||||| |||||| ||||||| ||||||||| |
|
|
| T |
5035298 |
cgattcccagaaaaaacaatgcttgaccagtgcgcatgtctctacgcacgaaccggattaatcatccacctttaatgggtcggaaacccatgcgaaagc |
5035396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 8410141 - 8410239
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||| ||||||||| |||||||||| |||||| ||||||||| || |||||||| ||| ||| |||| |||| |||||||||||||||||| |
|
|
| T |
8410141 |
cgattcccagggggaacaacacttggccagtgcgcatgcctctacgcacgagccggattagtcgcccacttttggggggtcggaaaccggtgcgaaagc |
8410239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 12455320 - 12455418
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||| |||| || |||||||||| |||||| |||||| ||||||||| || |||||||| ||| ||||| ||| ||||| |||||||||||||||||| |
|
|
| T |
12455320 |
cgatttccaggggaaacaacgcttagccagtgcgcatgcctctacgcacgagccggattagtcgctcaccattggtgggtcggaaaccggtgcgaaagc |
12455418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 14169694 - 14169608
Alignment:
| Q |
30 |
gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
||||||||| |||| ||||| ||||||||||||||||||| |||||||| |||| ||| ||| ||||| ||||||||||||||||| |
|
|
| T |
14169694 |
gggaacaacacttgaccagtgcgcatgtctctacgcatgagccggattagtcgtctaccattggtgggtcggaaaccggtgcgaaag |
14169608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 18902626 - 18902528
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||||| |||||||||||||| ||||| ||| |||||||||||| || || ||||| ||| |||||||| ||||| |||||||||||||||||| |
|
|
| T |
18902626 |
cgattcccacggggaacaacgcttgaccagtgcgcgtgtctctacgcacgagccagattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc |
18902528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 38005412 - 38005510
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||| |||||| ||||| |||||||| ||| |||||||| ||| | |||||| ||||||||||| |
|
|
| T |
38005412 |
cgattcccaaggggaacaacgcttggccagtgcgcatgcctctacacatgagccggattagtcgcccacctttggtggatcggaaactggtgcgaaagc |
38005510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 44139494 - 44139592
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||| |||||||||||||||||||| ||| || ||||||||| || |||||||| ||| |||| || ||||| |||||||||||||||||| |
|
|
| T |
44139494 |
cgattcccagggggaacaacgcttggccagtgcgcgtgcctctacgcacgagccggattagtcgcccaccaatggtgggtcggaaaccggtgcgaaagc |
44139592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 19 - 116
Target Start/End: Complemental strand, 6358247 - 6358150
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
||||| |||| ||||||||| |||||||||| |||||| |||||||||||| |||||||| |||| |||| ||| ||||| | ||||||||| ||||| |
|
|
| T |
6358247 |
cgatttccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgtccaccattggtgggtcgaaaaccggtgtgaaag |
6358150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 21 - 117
Target Start/End: Complemental strand, 42770745 - 42770649
Alignment:
| Q |
21 |
attcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||| ||| |||||||||||||||||||| |||||| |||| |||| || ||||||||||||| |||||||| ||||| | |||||| ||| ||||| |
|
|
| T |
42770745 |
attctcagggggaacaacgcttggccagtgcgcatgcctcttcgcacgagccggattaatcgtccacctttggtgggtcgaaaaccgatgcaaaagc |
42770649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 19 - 114
Target Start/End: Original strand, 34356216 - 34356311
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaa |
114 |
Q |
| |
|
||||| |||| ||||||||| ||||| |||| |||||| ||||| |||||| ||||||||||||| |||| ||||||||| |||||| ||||||| |
|
|
| T |
34356216 |
cgatttccagggggaacaacacttggtcagtgcgcatgcctctatgcatgagccggattaatcgtgcaccattgatgggtcggaaacgagtgcgaa |
34356311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 19 - 105
Target Start/End: Complemental strand, 10026712 - 10026626
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaac |
105 |
Q |
| |
|
|||||| ||| |||||||||| ||||||||| |||||| |||||||||||| |||||||| ||| |||||||| ||||| |||||| |
|
|
| T |
10026712 |
cgattctcagggggaacaacgtttggccagtgcgcatgcctctacgcatgagccggattagtcgaccacctttggtgggtcggaaac |
10026626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 33005772 - 33005858
Alignment:
| Q |
30 |
gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
||||||||| |||||||||| |||||| |||||||||||| | ||||||||| |||||||| ||||| |||||||| |||||||| |
|
|
| T |
33005772 |
gggaacaacacttggccagtgcgcatgcctctacgcatgaggcagattaatcgctcacctttagtgggtcggaaaccgatgcgaaag |
33005858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 34722690 - 34722788
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||| ||| | ||||||||||||| |||| | |||||||||||||| || |||||||| ||| |||||||||||| | ||||||||||||||||| |
|
|
| T |
34722690 |
cgattctcagggagaacaacgcttggtcagtgcacatgtctctacgcacgagccggattagtcgcccacctttgatggatcagaaaccggtgcgaaagc |
34722788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 19 - 116
Target Start/End: Original strand, 12864234 - 12864331
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
||||| |||| ||||||||| ||||| |||| |||||| |||| ||||||| || ||||| |||| |||| ||| ||||| ||||||||||||||||| |
|
|
| T |
12864234 |
cgatttccagggggaacaacacttggtcagtgcgcatgcctctgcgcatgagccagattagtcgtccaccattggtgggtcggaaaccggtgcgaaag |
12864331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 115
Target Start/End: Complemental strand, 20612622 - 20612534
Alignment:
| Q |
28 |
gagggaacaacgcttggccagtacgcatgtctctacgcatgaacc-ggattaatcgttcacctttgatgggttggaaaccggtgcgaaa |
115 |
Q |
| |
|
||||||||||| |||||||||| |||||| ||||| |||||| || |||||| |||| |||| ||| ||||| |||||||||||||||| |
|
|
| T |
20612622 |
gagggaacaacacttggccagtgcgcatgcctctatgcatgagccgggattagtcgtccaccattggtgggtcggaaaccggtgcgaaa |
20612534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 33 - 116
Target Start/End: Complemental strand, 3848996 - 3848913
Alignment:
| Q |
33 |
aacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
||||||| |||||||| |||||||||||||||| || ||||||| ||||||||||||||||||| | ||| |||||||||| |
|
|
| T |
3848996 |
aacaacgtttggccagggcgcatgtctctacgcacgagtcggattagtcgttcacctttgatgggtcgaaaattggtgcgaaag |
3848913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 30 - 117
Target Start/End: Original strand, 24179589 - 24179676
Alignment:
| Q |
30 |
gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||| ||||||||| | |||| |||||||||||| |||||||| |||| || ||||| |||||| |||||||||| ||||| |
|
|
| T |
24179589 |
gggaacaacgtttggccagtgcacatgcctctacgcatgagccggattagtcgtccatctttggtgggttaaaaaccggtgcaaaagc |
24179676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 33 - 116
Target Start/End: Original strand, 44773287 - 44773370
Alignment:
| Q |
33 |
aacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
||||||| ||||||||| ||||| |||| || ||| |||||||| ||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
44773287 |
aacaacgtttggccagtgtgcatgcctctgtgcgtgagccggattagtcgctcacctttgatgggtcggaaaccggtgcgaaag |
44773370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 29422225 - 29422323
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||| |||||||||||||| |||||||| | |||| || |||||| || |||||||| |||| |||||||||||| | ||||| |||||||||||| |
|
|
| T |
29422225 |
cgatttccagagggaacaacacttggccaatgagcatacctttacgcacgagccggattagtcgtccacctttgatggatcggaaatcggtgcgaaagc |
29422323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 35946759 - 35946845
Alignment:
| Q |
30 |
gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
|||||||||||||||||| | ||||| ||||||||| || |||||||| |||| |||| ||| ||||| |||||| |||||||||| |
|
|
| T |
35946759 |
gggaacaacgcttggccattgtgcatgcctctacgcacgagccggattagtcgtccaccattggtgggtcggaaactggtgcgaaag |
35946845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 20 - 117
Target Start/End: Original strand, 44945605 - 44945701
Alignment:
| Q |
20 |
gattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||||| |||||||||||| ||| |||||| ||||||||| || |||||||| ||| ||||||| ||| | |||||||||||||||||| |
|
|
| T |
44945605 |
gattcccagagg-aacaacgcttggatagtgcgcatgcctctacgcacgagccggattagtcgcccacctttagtggatcggaaaccggtgcgaaagc |
44945701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 41 - 116
Target Start/End: Complemental strand, 18649100 - 18649025
Alignment:
| Q |
41 |
ttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
|||| |||| |||||| |||||||||||| ||||||| ||| |||| |||| |||||||||||||| |||||||| |
|
|
| T |
18649100 |
ttgggcagtgcgcatgcctctacgcatgagtcggattagtcgctcacttttggtgggttggaaaccgttgcgaaag |
18649025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 2528437 - 2528339
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||| ||||||||||||||| |||| ||||| |||||| ||| | |||||||| ||| ||| |||| || || |||||| ||||||||||| |
|
|
| T |
2528437 |
cgattcccagggggaacaacgcttggtcagtgtgcatgcctctacacataagccggattagtcgctcatctttagtgagtcggaaactggtgcgaaagc |
2528339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 16813250 - 16813164
Alignment:
| Q |
30 |
gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
|||||||||| ||| |||||||||||| ||||| ||| || |||||||| |||| || ||||| | ||||||||| | ||||||||| |
|
|
| T |
16813250 |
gggaacaacgtttgaccagtacgcatgcctctatgcacgagccggattagtcgtccatctttggtaggttggaaatcagtgcgaaag |
16813164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 16852529 - 16852443
Alignment:
| Q |
30 |
gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
|||||||||| ||| |||||||||||| ||||| ||| || |||||||| |||| || ||||| | ||||||||| | ||||||||| |
|
|
| T |
16852529 |
gggaacaacgtttgaccagtacgcatgcctctatgcacgagccggattagtcgtccatctttggtaggttggaaatcagtgcgaaag |
16852443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 27 - 116
Target Start/End: Complemental strand, 9360836 - 9360747
Alignment:
| Q |
27 |
agagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
||||| ||||||| ||||||||| |||||| ||||||||| || ||| |||| ||| ||||||| |||| ||||||||||||||||| |
|
|
| T |
9360836 |
agaggaaacaacgtttggccagtgcgcatgcctctacgcacgagccgaattagtcgcccacctttagtgggccggaaaccggtgcgaaag |
9360747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 31 - 116
Target Start/End: Original strand, 16034959 - 16035044
Alignment:
| Q |
31 |
ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
||||||||||||| ||||| ||||| || |||| | || |||||||| ||| ||||| |||||| || ||||||||||||||||| |
|
|
| T |
16034959 |
ggaacaacgcttgaccagtgtgcatgcctatacgtacgagccggattagtcgctcaccattgatgagtcggaaaccggtgcgaaag |
16035044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 19 - 116
Target Start/End: Original strand, 21286454 - 21286551
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
|||||||||| | ||||||||||| ||||| |||||| ||||||||| || | |||||| || ||| | ||| |||||||||||||||||| |||| |
|
|
| T |
21286454 |
cgattcccaggcgaaacaacgcttgaccagtgcgcatgcctctacgcacgagctggattagtcactcatcattggtgggttggaaaccggtgcaaaag |
21286551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 7787066 - 7787158
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgc |
111 |
Q |
| |
|
||||| |||| |||||||| ||||||||||||||||| ||||||||| || |||||||| ||| || ||||| ||| | | |||||||||| |
|
|
| T |
7787066 |
cgatttccagggggaacaatacttggccagtacgcatgcctctacgcacgagccggattagtcgcccatctttggtggatcgaaaaccggtgc |
7787158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 30 - 117
Target Start/End: Complemental strand, 31596517 - 31596430
Alignment:
| Q |
30 |
gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||| | ||||||||| | ||| ||||||||||| | | ||||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
31596517 |
gggaacaatgtttggccagtgcacatacttctacgcatgagctgaattaatcgtctacctttgatgaattggaaaccggtgcgaaagc |
31596430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 32 - 69
Target Start/End: Complemental strand, 13104908 - 13104871
Alignment:
| Q |
32 |
gaacaacgcttggccagtacgcatgtctctacgcatga |
69 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
13104908 |
gaacaacgcttggccagtgcgcatgcctctacgcatga |
13104871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 31 - 116
Target Start/End: Original strand, 27725962 - 27726047
Alignment:
| Q |
31 |
ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
||||||| ||||||||||| |||||| ||||||||| | |||||||| ||| |||| || ||||| ||||||||||| ||||| |
|
|
| T |
27725962 |
ggaacaatgcttggccagtgcgcatgcctctacgcactagccggattagtcgcccaccaatggtgggtcggaaaccggtgtgaaag |
27726047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 30 - 115
Target Start/End: Complemental strand, 43303377 - 43303292
Alignment:
| Q |
30 |
gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaa |
115 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||| ||| || | |||||||||| || | |||||||| |||| |||||||||| |
|
|
| T |
43303377 |
gggaacaacgcttgaccagtacgcatgcctctatgcacgagctggattaatcgcccatcaatgatgggtcagaaatcggtgcgaaa |
43303292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 51 - 115
Target Start/End: Original strand, 21641992 - 21642056
Alignment:
| Q |
51 |
cgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaa |
115 |
Q |
| |
|
|||||| |||||||||||| ||| |||||||| | |||||| ||||| | |||||||||||||| |
|
|
| T |
21641992 |
cgcatgcctctacgcatgagccgaattaatcgcccgcctttggtgggtcgaaaaccggtgcgaaa |
21642056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 61 - 117
Target Start/End: Original strand, 44023347 - 44023403
Alignment:
| Q |
61 |
tacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||||| || |||| |||| || ||||| |||||||||||||||||||||||| |
|
|
| T |
44023347 |
tacgcatgagtcgaattagtcgtccatctttggtgggttggaaaccggtgcgaaagc |
44023403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 59; Significance: 4e-25; HSPs: 63)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 7650237 - 7650335
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||| |||| ||||||||| ||||||||||||| ||||||||||||| || |||||||| ||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
7650237 |
cgatttccagggggaacaacacttggccagtacgaatgtctctacgcacgagccggattagtcgcccacctttggtgggttggaaaccggtgcgaaagc |
7650335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 47219154 - 47219252
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||||| || ||||||||||||| ||| |||||| |||||||||||| |||||||| |||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
47219154 |
cgattcccaagggaaacaacgcttggctagtgcgcatgcctctacgcatgagccggattagtcgtccacctttgatgggtcggaaaccggtgcgaaagc |
47219252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 31 - 116
Target Start/End: Original strand, 54261248 - 54261333
Alignment:
| Q |
31 |
ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||||||| |||||||| |||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
54261248 |
ggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgttcacctttagtgggtcggaaaccggtgcgaaag |
54261333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 19 - 115
Target Start/End: Original strand, 53649737 - 53649833
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaa |
115 |
Q |
| |
|
|||||| ||| | ||||||| |||||||||| ||| ||||||||||||||| |||||||| ||||||||||||||||| | |||||||||||||||| |
|
|
| T |
53649737 |
cgattctcagggtgaacaacacttggccagtgcgcctgtctctacgcatgagccggattagtcgttcacctttgatggatcggaaaccggtgcgaaa |
53649833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 20 - 115
Target Start/End: Complemental strand, 3507629 - 3507534
Alignment:
| Q |
20 |
gattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaa |
115 |
Q |
| |
|
|||||| |||||||||||| |||||||||| |||||| ||||||||| || |||||||| ||| ||||||||| ||||| |||||||||||||||| |
|
|
| T |
3507629 |
gattcctagagggaacaacacttggccagtgcgcatgcctctacgcacgagccggattagtcgctcacctttggtgggtcggaaaccggtgcgaaa |
3507534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 28572308 - 28572210
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||| || |||||||||||||||||| ||||| ||||||||| || |||||||| ||| |||||||| ||||| |||||||||||||||||| |
|
|
| T |
28572308 |
cgattcccaggggaaacaacgcttggccagtatgcatgcctctacgcacgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc |
28572210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 29135923 - 29136021
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||| ||||||||| |||||||||| |||||| |||||||||||| |||||||| || | |||| ||| |||||||||||||||| ||||||| |
|
|
| T |
29135923 |
cgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcttccaccattggtgggttggaaaccggtacgaaagc |
29136021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 19 - 116
Target Start/End: Original strand, 45877464 - 45877561
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
||||| |||| || |||||| |||||||||| | |||| |||||||||||| |||||||| ||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
45877464 |
cgatttccaggggaaacaacacttggccagtgcacatgcctctacgcatgagccggattagtcgttcaccattgatgggtcggaaaccggtgcgaaag |
45877561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 31072888 - 31072986
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||| |||| ||||||||||||||| |||| | |||| ||||||||| || || |||||||||| |||||||| | |||||||||||||||||||||| |
|
|
| T |
31072888 |
cgatttccagggggaacaacgcttggtcagtgcacatgcctctacgcacgacccagattaatcgtccacctttggtaggttggaaaccggtgcgaaagc |
31072986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 51060378 - 51060280
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||| ||| ||||||||| ||||| |||| |||||| |||||||||||||| |||||| |||| |||| ||| ||||| |||||||||||||||||| |
|
|
| T |
51060378 |
cgattctcagggggaacaacacttggtcagtgcgcatgcctctacgcatgaactggattagtcgtccaccattggtgggtcggaaaccggtgcgaaagc |
51060280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 20 - 117
Target Start/End: Complemental strand, 55069775 - 55069678
Alignment:
| Q |
20 |
gattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||| | ||||||||||| ||||||||| | |||| ||||||||| || |||||||||||| ||||||||| ||||| |||||||||||| ||||| |
|
|
| T |
55069775 |
gattcctatagggaacaacgtttggccagtgcacatgcctctacgcacgagccggattaatcgctcacctttggtgggtcggaaaccggtgcaaaagc |
55069678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 33 - 117
Target Start/End: Original strand, 25294984 - 25295068
Alignment:
| Q |
33 |
aacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||| |||||||||| |||||| ||||| |||||| |||||||| |||| |||| ||| |||||||||||||||||||||||| |
|
|
| T |
25294984 |
aacaacacttggccagtgcgcatgcctctatgcatgagccggattagtcgtccaccattggtgggttggaaaccggtgcgaaagc |
25295068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 30 - 117
Target Start/End: Original strand, 23511588 - 23511675
Alignment:
| Q |
30 |
gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||| ||||| ||| ||||| |||||| |||||||||||| |||||||||||| |||||||||||||| | |||||||||||||||| |
|
|
| T |
23511588 |
gggagcaacgtttgaccagtgcgcatgcctctacgcatgagtcggattaatcgtccacctttgatgggtcgaaaaccggtgcgaaagc |
23511675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 7328854 - 7328951
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||| ||||||||| |||||||||| |||||| || ||||||||| |||||||| ||| |||||||| ||||| | |||||||||||||||| |
|
|
| T |
7328854 |
cgattcccagggggaacaacacttggccagtgcgcatgcct-tacgcatgagccggattagtcgcccacctttggtgggtcgaaaaccggtgcgaaagc |
7328951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 30 - 112
Target Start/End: Original strand, 10040577 - 10040659
Alignment:
| Q |
30 |
gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcg |
112 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||||| || ||||| | |||| |||||||| ||||||||||||||||||| |
|
|
| T |
10040577 |
gggaacaacgcttggccagtgcgcatgcctctacgcacgagccggaatggtcgtccacctttggtgggttggaaaccggtgcg |
10040659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 26043822 - 26043920
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||| | ||||||| |||||||||| |||||| |||||||||||| |||||||| ||| ||||||||| || || |||||||| |||||||| |
|
|
| T |
26043822 |
cgattcccagggagaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgctcacctttggtgagtcagaaaccggggcgaaagc |
26043920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 30045831 - 30045929
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||| || |||||||||||||||||||| |||||||||||||||| || | ||||| |||| |||||||||||||| | |||| |||||||||| |
|
|
| T |
30045831 |
cgattcctagggggaacaacgcttggccagtgcgcatgtctctacgcacgagtctgattagtcgtccacctttgatgggtcgtaaactagtgcgaaagc |
30045929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 19 - 116
Target Start/End: Original strand, 35315966 - 35316063
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
|||||||||| ||||||||| |||||||||| |||||| |||||||||||| | |||||| ||| ||| |||| ||||| |||||||| |||||||| |
|
|
| T |
35315966 |
cgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagctggattagtcgcccacttttggtgggtcggaaaccgatgcgaaag |
35316063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 31 - 111
Target Start/End: Complemental strand, 40660412 - 40660332
Alignment:
| Q |
31 |
ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgc |
111 |
Q |
| |
|
|||||||| |||| |||| |||||| |||||||||||||||||||||||| |||||||||| ||||| | |||||||||| |
|
|
| T |
40660412 |
ggaacaacatttggtcagtgcgcatgcctctacgcatgaaccggattaatcattcacctttggtgggtcgaaaaccggtgc |
40660332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 21 - 117
Target Start/End: Original strand, 48342032 - 48342128
Alignment:
| Q |
21 |
attcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||| || |||||||||||||||| ||| |||||| ||||||||||||||| ||||| |||| || ||||| ||| | |||||| ||||||||||| |
|
|
| T |
48342032 |
attcctagggggaacaacgcttggctagtgcgcatgcctctacgcatgaaccagattagtcgtccatctttggtggatcggaaacaggtgcgaaagc |
48342128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 19 - 103
Target Start/End: Complemental strand, 52364897 - 52364813
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaa |
103 |
Q |
| |
|
||||||||||| ||||||||||||| ||||| |||||| ||||||||| || | ||||||||||| ||||||||||||| |||| |
|
|
| T |
52364897 |
cgattcccagaaggaacaacgcttgaccagtgcgcatgcctctacgcacgagctggattaatcgtctacctttgatgggtcggaa |
52364813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 30 - 117
Target Start/End: Complemental strand, 3136780 - 3136693
Alignment:
| Q |
30 |
gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||||| ||||| |||| |||||| |||||||||||| ||||||| |||| |||||||| | ||| |||||||||||||||||| |
|
|
| T |
3136780 |
gggaacaacacttgggcagtgcgcatgcctctacgcatgagtcggattagtcgtccacctttggttggtcggaaaccggtgcgaaagc |
3136693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 29127929 - 29128027
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||| |||| | ||||||| ||||| |||| |||||| |||||||||||| |||||||| ||| |||||||| ||||| |||||||| ||||||||| |
|
|
| T |
29127929 |
cgatttccagggagaacaacacttggtcagtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccgatgcgaaagc |
29128027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 33251672 - 33251770
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||| | |||||||||| ||||||||| ||||| |||||||||||| |||||||| |||| ||| |||||||||| | |||| |||||||||| |
|
|
| T |
33251672 |
cgattcccggtgggaacaacgtttggccagtgtgcatgcctctacgcatgagccggattagtcgtccacatttgatgggtcgaaaacgagtgcgaaagc |
33251770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 51 - 117
Target Start/End: Original strand, 44064586 - 44064652
Alignment:
| Q |
51 |
cgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||| ||||||||||||||||||||| ||| ||||||||| ||||| |||||||||||| ||||| |
|
|
| T |
44064586 |
cgcatgcctctacgcatgaaccggattagtcgctcacctttggtgggtcggaaaccggtgcaaaagc |
44064652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 19 - 105
Target Start/End: Complemental strand, 45402448 - 45402362
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaac |
105 |
Q |
| |
|
||||||| |||||||||||| || |||| || |||||| |||||||||||| |||||||| |||||||||||| ||||| |||||| |
|
|
| T |
45402448 |
cgattcctagagggaacaacactcggcctgtgcgcatgcctctacgcatgagccggattagtcgttcacctttagtgggtcggaaac |
45402362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 45450533 - 45450447
Alignment:
| Q |
30 |
gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
|||||||| ||||| ||||| |||||| |||||||||| | | ||||| |||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
45450533 |
gggaacaatgcttgaccagtgcgcatgcctctacgcataagctagattagtcgtccacctttgatgagttggaaaccggtgcgaaag |
45450447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 20 - 117
Target Start/End: Complemental strand, 26362063 - 26361966
Alignment:
| Q |
20 |
gattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||| |||||||||| |||| |||| ||||| ||||||||| || |||||||| ||| |||||||||||||| ||||||||||| |||||| |
|
|
| T |
26362063 |
gattcccaaggggaacaacgtttggtcagtgtgcatgcctctacgcacgagccggattagtcgcacacctttgatgggtcggaaaccggtgtgaaagc |
26361966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 19 - 116
Target Start/End: Complemental strand, 29762252 - 29762155
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
|||||| ||| || |||||| |||||||||| |||||| ||||| |||||| | |||||| |||| |||| ||| ||||| ||||||||||||||||| |
|
|
| T |
29762252 |
cgattctcaggggcaacaacacttggccagtgcgcatgcctctatgcatgagctggattagtcgtccaccattggtgggtcggaaaccggtgcgaaag |
29762155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 19 - 116
Target Start/End: Original strand, 47471842 - 47471938
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
|||||||||| |||||||| ||||||| ||| |||||| ||||||||||| ||| |||| |||| |||||||| ||||| |||||||| |||||||| |
|
|
| T |
47471842 |
cgattcccag-gggaacaatgcttggctagtgcgcatgcttctacgcatgagccgaattagtcgtccacctttggtgggtcggaaaccgatgcgaaag |
47471938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 32 - 117
Target Start/End: Original strand, 54237471 - 54237556
Alignment:
| Q |
32 |
gaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||| ||||| |||| ||||||||||||||||||| |||||| | |||| |||| || ||||| |||||||||||||||||| |
|
|
| T |
54237471 |
gaacaacacttggtcagtgcgcatgtctctacgcatgagccggataagtcgtccaccattagtgggtcggaaaccggtgcgaaagc |
54237556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 19 - 115
Target Start/End: Original strand, 6462422 - 6462518
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaa |
115 |
Q |
| |
|
|||||| ||| | |||||||||||||||||| |||||| |||||||||||| |||||||| ||| || || |||||||||||||||||||||| |
|
|
| T |
6462422 |
cgattcacagggagaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgaccattattagtgggttggaaaccggtgcgaaa |
6462518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 20 - 116
Target Start/End: Original strand, 10855395 - 10855490
Alignment:
| Q |
20 |
gattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
|||| |||| ||||||||||||||||||||||||||| ||||||||| |||||| |||| ||| || ||||| ||||||| ||| || |||||||| |
|
|
| T |
10855395 |
gatttccagggggaacaacgcttggccagtacgcatgcctctacgcacgaaccgaattagtcg-ccatctttgttgggttgaaaatcgatgcgaaag |
10855490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 45 - 117
Target Start/End: Complemental strand, 49021274 - 49021202
Alignment:
| Q |
45 |
ccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||| |||||| |||||||||||| |||||||| |||| |||| ||| ||||| |||||||||||||||||| |
|
|
| T |
49021274 |
ccagtgcgcatgcctctacgcatgagccggattagtcgtccaccattggtgggtcggaaaccggtgcgaaagc |
49021202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 92
Target Start/End: Original strand, 3755580 - 3755653
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttg |
92 |
Q |
| |
|
|||||||||| ||||||||| ||| ||||| ||||||||||||||||||| |||||||| |||| ||||||| |
|
|
| T |
3755580 |
cgattcccaggaggaacaacgtttgaccagtgcgcatgtctctacgcatgagccggattagtcgtctacctttg |
3755653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 31 - 116
Target Start/End: Original strand, 22909805 - 22909890
Alignment:
| Q |
31 |
ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
||||||||||| ||| ||| ||||| ||||||||||| ||| |||| |||| |||||||||||||| ||||||| ||||||||| |
|
|
| T |
22909805 |
ggaacaacgctaggctagtgcgcatacttctacgcatgagccgaattagtcgtgcacctttgatgggtcggaaaccagtgcgaaag |
22909890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 88
Target Start/End: Original strand, 49198361 - 49198430
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacc |
88 |
Q |
| |
|
||||||| || ||||||||| |||||||||| |||||| |||||||||||| |||||||| |||| |||| |
|
|
| T |
49198361 |
cgattcctagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgtccacc |
49198430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 33 - 117
Target Start/End: Original strand, 2668085 - 2668169
Alignment:
| Q |
33 |
aacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||| |||||||||| |||||| ||||||||| || | |||||| ||| |||||||| ||||||||||| | |||||||||| |
|
|
| T |
2668085 |
aacaacacttggccagtgcgcatgcctctacgcaagagctggattagtcgctcacctttagtgggttggaaatcagtgcgaaagc |
2668169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 31 - 115
Target Start/End: Complemental strand, 34662404 - 34662320
Alignment:
| Q |
31 |
ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaa |
115 |
Q |
| |
|
|||| |||| |||| ||||||||||||||||| |||||| ||| |||| |||| ||||||| ||| |||||||||| ||||||| |
|
|
| T |
34662404 |
ggaataacgtttggtcagtacgcatgtctctatgcatgagccgaattagtcgtccacctttagtggattggaaaccgatgcgaaa |
34662320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 21 - 117
Target Start/End: Complemental strand, 41630607 - 41630511
Alignment:
| Q |
21 |
attcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||| |||||||||||||| ||||| |||||| |||||| ||||| |||||||| ||| |||||||| | ||| |||||| |||| |||||| |
|
|
| T |
41630607 |
attcccaaggggaacaacgcttgcccagtgcgcatgcctctacacatgagccggattagtcgcccacctttggttggtcggaaactggtgtgaaagc |
41630511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 33 - 116
Target Start/End: Complemental strand, 37319972 - 37319889
Alignment:
| Q |
33 |
aacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
||||||||||| | ||| ||||| ||||||||| || | | ||||||||| |||| |||||||||||||||| |||||||||| |
|
|
| T |
37319972 |
aacaacgcttgacaagtgtgcatgcctctacgcacgagctgaattaatcgtccaccgttgatgggttggaaactggtgcgaaag |
37319889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 19 - 78
Target Start/End: Original strand, 39849082 - 39849140
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggatta |
78 |
Q |
| |
|
||||||||||||| ||||||||||||||||| ||||| |||||||||||| |||||||| |
|
|
| T |
39849082 |
cgattcccagagg-aacaacgcttggccagtgtgcatgcctctacgcatgagccggatta |
39849140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 33 - 115
Target Start/End: Complemental strand, 2029350 - 2029268
Alignment:
| Q |
33 |
aacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaa |
115 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||| | |||||| ||| |||| ||||||||| | ||||| |||||||| |
|
|
| T |
2029350 |
aacaacgcttggttagtacgcatgcctctacgcatgagctggattagtcgcccaccattgatgggtcgcaaaccagtgcgaaa |
2029268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 31 - 117
Target Start/End: Original strand, 15320208 - 15320294
Alignment:
| Q |
31 |
ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||| | ||||||||| ||||| ||||||||| || |||||||| ||| |||||||| ||||| ||||||||||||||||| |
|
|
| T |
15320208 |
ggaacaatgattggccagtgtgcatgcctctacgcacgagccggattagtcgcccacctttggtgggtcagaaaccggtgcgaaagc |
15320294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 21 - 114
Target Start/End: Original strand, 8362589 - 8362682
Alignment:
| Q |
21 |
attcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaa |
114 |
Q |
| |
|
|||||||| || ||||||| ||||||||| |||||| |||||||||||| || |||| |||| ||||||| ||| | |||||||||||||| |
|
|
| T |
8362589 |
attcccagtggaaacaacgtttggccagtccgcatgcctctacgcatgagccaaattagtcgtccacctttagtggatccgaaaccggtgcgaa |
8362682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 20 - 117
Target Start/End: Original strand, 13893937 - 13894034
Alignment:
| Q |
20 |
gattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||| |||| ||||||||||||||| || | |||||| |||||| || || |||||||| ||| |||||||| ||| | | |||||||||||||||| |
|
|
| T |
13893937 |
gatttccagggggaacaacgcttggtcaatgcgcatgcctctacacacgagccggattagtcgcccacctttggtggatcgaaaaccggtgcgaaagc |
13894034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 31 - 116
Target Start/End: Original strand, 19146983 - 19147068
Alignment:
| Q |
31 |
ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
||||||||||||||||||| | || ||||| ||| || | |||||| |||| |||||||| ||||| ||||||||||||||||| |
|
|
| T |
19146983 |
ggaacaacgcttggccagtgtgtatccctctatgcacgagctggattagtcgtccacctttggtgggtcggaaaccggtgcgaaag |
19147068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 30 - 111
Target Start/End: Original strand, 33688972 - 33689053
Alignment:
| Q |
30 |
gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgc |
111 |
Q |
| |
|
||||| ||| |||||||||| |||||| |||||||||||| || | ||| || | |||| ||| |||||||||||||||||| |
|
|
| T |
33688972 |
gggaataacacttggccagtgcgcatgcctctacgcatgagccagtttagtcatccaccattggtgggttggaaaccggtgc |
33689053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 19 - 88
Target Start/End: Complemental strand, 42412871 - 42412802
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacc |
88 |
Q |
| |
|
|||||||| | |||||||||||||||| ||| | |||| |||||||||||| |||||||| ||| ||||| |
|
|
| T |
42412871 |
cgattcccggggggaacaacgcttggcaagtgcccatgcctctacgcatgagccggattagtcgctcacc |
42412802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 33 - 117
Target Start/End: Complemental strand, 24506731 - 24506647
Alignment:
| Q |
33 |
aacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||||||| ||||| | |||| |||||||||||| | ||||| ||| ||||| ||| ||||| |||||||||||| ||||| |
|
|
| T |
24506731 |
aacaacgcttgaccagtgcacatgcctctacgcatgagtcagattagtcgctcaccattggtgggtcggaaaccggtgcaaaagc |
24506647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 53 - 117
Target Start/End: Complemental strand, 29195382 - 29195318
Alignment:
| Q |
53 |
catgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||| |||||| |||||||| ||||| |||| ||||||| |||||||||||||||| ||||||| |
|
|
| T |
29195382 |
catgcctctacacatgaaccagattagtcgtccacctttagtgggttggaaaccggtacgaaagc |
29195318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 50405700 - 50405608
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgc |
111 |
Q |
| |
|
||||||| || || ||||||||||| ||||| |||||| ||||||||| || ||||||| ||| |||| ||| ||||| |||||||||||| |
|
|
| T |
50405700 |
cgattccgaggggaaacaacgcttgaccagtgcgcatgcctctacgcacgagtcggattagtcgcccaccattggtgggtcggaaaccggtgc |
50405608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 19 - 115
Target Start/End: Complemental strand, 51683051 - 51682955
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaa |
115 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| |||||| |||| | || || |||||||| ||| |||| || ||||| ||||||| |||||||| |
|
|
| T |
51683051 |
cgattcccagggggaacaacgcttgaccagtgcgcatgcctctccacacgagccggattagtcgcccaccaatggtgggtcggaaaccagtgcgaaa |
51682955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 31 - 94
Target Start/End: Original strand, 3763072 - 3763135
Alignment:
| Q |
31 |
ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgat |
94 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||| |||| |||||| |||| |||| ||||| |
|
|
| T |
3763072 |
ggaacaacgcttggtcagtgtgcatgtctctacgcacgaactggattagtcgtccaccattgat |
3763135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 19 - 114
Target Start/End: Original strand, 4638164 - 4638259
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaa |
114 |
Q |
| |
|
|||||||||| | ||||||||||| ||||| ||||| ||||||||| || |||||||| | | ||||||| |||||| |||||||| |||||| |
|
|
| T |
4638164 |
cgattcccaggagaaacaacgcttgaccagtgcgcatacctctacgcacgagccggattagtagcccacctttaatgggtcggaaaccgatgcgaa |
4638259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 19 - 78
Target Start/End: Complemental strand, 26207898 - 26207839
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggatta |
78 |
Q |
| |
|
||||||||| |||||||||||||| ||||| ||||| |||||||||||| |||||||| |
|
|
| T |
26207898 |
cgattcccacggggaacaacgcttgtccagtgtgcatgcctctacgcatgagccggatta |
26207839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 19 - 98
Target Start/End: Original strand, 40944893 - 40944971
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggt |
98 |
Q |
| |
|
|||||||||| ||||||||| ||| |||||| ||||| ||||||||||| | ||||||| ||| ||||||||| ||||| |
|
|
| T |
40944893 |
cgattcccagggggaacaacacttaaccagtatgcatgcctctacgcatg-agcggattagtcgctcacctttggtgggt |
40944971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 928610 - 928708
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||| ||| ||||||||| |||| ||||| |||||| | ||||||| || |||||||| || | |||||||| || || | ||| |||||||||||| |
|
|
| T |
928610 |
cgattctcagggggaacaacacttgaccagtgcgcatgccgctacgcacgagccggattagtcatccacctttggtgagtcgaaaatcggtgcgaaagc |
928708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 13367445 - 13367531
Alignment:
| Q |
30 |
gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
||||||||||||||| |||| ||||| || ||||||||| |||||||| || ||| ||| ||||| ||||||||||||||||| |
|
|
| T |
13367445 |
gggaacaacgcttggtcagtgtgcatgcctttacgcatgagccggattagtcacctaccgttgttgggtaggaaaccggtgcgaaag |
13367531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 71 - 117
Target Start/End: Original strand, 21325126 - 21325172
Alignment:
| Q |
71 |
ccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||||| || ||||||||||| |||||||||||||||||| |
|
|
| T |
21325126 |
ccggattaatcgcccatctttgatgggtcggaaaccggtgcgaaagc |
21325172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 60 - 117
Target Start/End: Complemental strand, 36043730 - 36043673
Alignment:
| Q |
60 |
ctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||| || |||||||| ||| |||||||| ||||| |||||||||||||||||| |
|
|
| T |
36043730 |
ctacgcacgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaagc |
36043673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 53 - 117
Target Start/End: Original strand, 10043726 - 10043790
Alignment:
| Q |
53 |
catgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||| ||||||||| || | ||||||||| ||||| ||| ||||| |||||||||||||||||| |
|
|
| T |
10043726 |
catgcctctacgcacgaggcagattaatcgctcaccattggtgggtcggaaaccggtgcgaaagc |
10043790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 33 - 117
Target Start/End: Complemental strand, 35998654 - 35998570
Alignment:
| Q |
33 |
aacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||||||| |||| | |||| ||||||||| || ||||||||||| ||||||| ||||| ||||||||||||||||| |
|
|
| T |
35998654 |
aacaacgcttgatcagtgcacatgcctctacgcacgagttggattaatcgtccacctttagtgggtcagaaaccggtgcgaaagc |
35998570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 57; Significance: 7e-24; HSPs: 37)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 19 - 115
Target Start/End: Complemental strand, 4479391 - 4479296
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaa |
115 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |||||| |||||||||||| | |||||| |||| |||||||| ||||| |||||||||||||||| |
|
|
| T |
4479391 |
cgattcccag-gggaacaacgcttggccagtgcgcatgcctctacgcatgagctggattagtcgtccacctttggtgggtcggaaaccggtgcgaaa |
4479296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 31 - 117
Target Start/End: Original strand, 10927632 - 10927718
Alignment:
| Q |
31 |
ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||||||| |||||||| |||||||||||| ||||| |||||||| ||||||||| |
|
|
| T |
10927632 |
ggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgttcacctttagtgggtcggaaaccgatgcgaaagc |
10927718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 45521183 - 45521280
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||| ||||||||| |||| |||| |||||| |||||||||||| |||||||| ||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
45521183 |
cgattcccag-gggaacaacacttgatcagtgcgcatgcctctacgcatgagccggattagtcgctcacctttgatgggtcggaaaccggtgcgaaagc |
45521280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 19 - 91
Target Start/End: Complemental strand, 1013073 - 1013001
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcaccttt |
91 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |||| |||||||||||| ||| ||||||||||||||||| |
|
|
| T |
1013073 |
cgattcccagggggaacaacgcttggccagtacacatgcctctacgcatgagccgaattaatcgttcaccttt |
1013001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 6100486 - 6100584
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |||||| | |||||||||| |||||||| |||||||||||| ||||| | |||||| ||||||||| |
|
|
| T |
6100486 |
cgattcccaggaggaacaacgcttggccagtgcgcatgccactacgcatgagccggattagtcgttcacctttagtgggtcgaaaaccgctgcgaaagc |
6100584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 43032915 - 43033013
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |||||| |||||| || || |||||||| ||| |||||||| ||||| ||||||||||||||||| |
|
|
| T |
43032915 |
cgattcccagggggaacaacgcttggccagtgcgcatgcctctacacacgagccggattagtcgcccacctttggtgggtcagaaaccggtgcgaaagc |
43033013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 31 - 116
Target Start/End: Complemental strand, 68182 - 68097
Alignment:
| Q |
31 |
ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
||||||||| |||||||||| ||||| || ||| || || |||||||||||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
68182 |
ggaacaacgtttggccagtatgcatgcctttacacacgagccggattaatcgttcacctttgatgggtcggaaaccggtgcaaaag |
68097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 29 - 117
Target Start/End: Original strand, 583836 - 583924
Alignment:
| Q |
29 |
agggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||||||||||| ||||| |||||| |||||||||||| ||||||| ||| |||||||||||| || ||||||||||||||||| |
|
|
| T |
583836 |
agggaacaacgcttgaccagtgcgcatgcctctacgcatgagtcggattagtcgcccacctttgatggattagaaaccggtgcgaaagc |
583924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 26 - 117
Target Start/End: Complemental strand, 11298356 - 11298265
Alignment:
| Q |
26 |
cagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||||||||| ||| |||||| |||||| ||||| |||||| || |||||||| ||||||||| ||||| |||||||||||||||||| |
|
|
| T |
11298356 |
cagagggaacaacacttagccagtgcgcatgcctctatgcatgagccaaattaatcgctcacctttggtgggtcggaaaccggtgcgaaagc |
11298265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 2467214 - 2467116
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||| |||| ||||||||| |||||||||| |||||||||||| |||||| |||||||| |||| ||| ||| || || |||||||||||||||||| |
|
|
| T |
2467214 |
cgatttccagggggaacaactcttggccagtgcgcatgtctctatgcatgagccggattagtcgtccacaattggtgtgtcggaaaccggtgcgaaagc |
2467116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 43027319 - 43027417
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||| ||||||||| ||| ||| | |||||| |||||||||||| |||||||| |||| || ||||||||||| |||||||| ||||||||| |
|
|
| T |
43027319 |
cgattcccaggaggaacaacgattgtccaatgcgcatgcctctacgcatgagccggattagtcgtccatctttgatgggtcggaaaccgatgcgaaagc |
43027417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 44893363 - 44893277
Alignment:
| Q |
30 |
gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
|||||||| ||||||||||| ||||| ||||||||| || |||||||||||| ||||| ||||||||| |||||||||||| |||| |
|
|
| T |
44893363 |
gggaacaatgcttggccagtgtgcatgcctctacgcacgagccggattaatcgctcacccttgatgggtcggaaaccggtgcaaaag |
44893277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 19 - 115
Target Start/End: Complemental strand, 15884651 - 15884556
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaa |
115 |
Q |
| |
|
|||||||||| ||||||||| |||||| ||| |||||| ||||||||| || |||||||| ||| |||||||| ||||| |||||||||||||||| |
|
|
| T |
15884651 |
cgattcccag-gggaacaacacttggcaagtgcgcatgcctctacgcacgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaa |
15884556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 32 - 116
Target Start/End: Original strand, 23895595 - 23895679
Alignment:
| Q |
32 |
gaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||| || ||||||||||| |||||||||||||| |||||| |||||||||| |
|
|
| T |
23895595 |
gaacaacgcttggccagtgcgcatacctctacgcacgagatggattaatcgtccacctttgatgggtcggaaacgggtgcgaaag |
23895679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 30 - 117
Target Start/End: Complemental strand, 8997629 - 8997542
Alignment:
| Q |
30 |
gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||| || |||||| |||||| || ||||||||| || ||||| ||||||| ||||| ||||| |||||||||||||||||| |
|
|
| T |
8997629 |
gggaacaacgtttcgccagttcgcatgcctatacgcatgagccagattagtcgttcatctttggtgggtcggaaaccggtgcgaaagc |
8997542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 31 - 117
Target Start/End: Original strand, 2964102 - 2964188
Alignment:
| Q |
31 |
ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||||||||||||| | ||||| ||||||||| ||||||||||| ||| |||||||| ||||| ||||||||||||||||| |
|
|
| T |
2964102 |
ggaacaacgcttggccaatgtgcatgcctctacgcacgaaccggattagtcgcccacctttggtgggtcagaaaccggtgcgaaagc |
2964188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 19 - 116
Target Start/End: Original strand, 18374024 - 18374121
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
|||||| ||| | |||||||||||| ||||| |||||| |||||||||||| |||||||| |||| || ||||| ||||| | |||||||||| |||| |
|
|
| T |
18374024 |
cgattctcagggagaacaacgcttgaccagtgcgcatgcctctacgcatgagccggattagtcgtccaactttggtgggtcgaaaaccggtgcaaaag |
18374121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 21 - 117
Target Start/End: Original strand, 26570940 - 26571036
Alignment:
| Q |
21 |
attcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||| || |||||||||||||||||||| | ||| ||||||||||| |||||||| |||| ||||||||||| || |||||||| || |||||| |
|
|
| T |
26570940 |
attcctagggggaacaacgcttggccagtgtgtatgcatctacgcatgagccggattagtcgtccacctttgatgagtcggaaaccgatgtgaaagc |
26571036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 30 - 117
Target Start/End: Complemental strand, 10535489 - 10535402
Alignment:
| Q |
30 |
gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||| |||||| ||||| |||||||||| |||||||| ||| |||| ||||||||||||| | || |||||| ||||||||||| |
|
|
| T |
10535489 |
gggaacaccgcttgaccagtgcgcatgtctccacgcatgagccgaattagtcgttcacctttggtaagtcggaaactggtgcgaaagc |
10535402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 30 - 117
Target Start/End: Complemental strand, 16291288 - 16291201
Alignment:
| Q |
30 |
gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||||| |||||||||||| |||| ||||| |||||| | |||||| ||| ||||||||| ||||| | ||||||||| |||||| |
|
|
| T |
16291288 |
gggaacaacacttggccagtacacatgcctctatgcatgagctggattagtcgctcacctttggtgggtcgaaaaccggtgtgaaagc |
16291201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 8141116 - 8141214
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||| |||| || ||||||||||||||||| |||||| |||||||||||| | | |||| |||| ||| |||| ||||| ||||||| ||||||||| |
|
|
| T |
8141116 |
cgatttccaggggaaacaacgcttggccagtgcgcatgcctctacgcatgagctgaattagtcgtccacatttggtgggtcagaaaccgatgcgaaagc |
8141214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 33 - 109
Target Start/End: Complemental strand, 24938644 - 24938568
Alignment:
| Q |
33 |
aacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggt |
109 |
Q |
| |
|
|||||| ||||| || | |||||| ||||||||||||||||||||| || | |||||||||||| | |||||||||| |
|
|
| T |
24938644 |
aacaacacttggtcaatgcgcatgcctctacgcatgaaccggattagtcatccacctttgatggatcggaaaccggt |
24938568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 21 - 76
Target Start/End: Complemental strand, 8587033 - 8586978
Alignment:
| Q |
21 |
attcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggat |
76 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||||| |||||||||||| |||||| |
|
|
| T |
8587033 |
attcccagggggaacaacgcttggccagtgcgcatacctctacgcatgagccggat |
8586978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 19 - 66
Target Start/End: Complemental strand, 38922510 - 38922463
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgca |
66 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| || |||||| |
|
|
| T |
38922510 |
cgattcccagagggaacaacgcttggccagtgcgcatgcctttacgca |
38922463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 31 - 117
Target Start/End: Complemental strand, 3418597 - 3418511
Alignment:
| Q |
31 |
ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||| |||||||||| |||||| ||||||||||| | ||||| |||| ||||||| ||||| ||||||||||||||||| |
|
|
| T |
3418597 |
ggaacaacacttggccagtgcgcatgcgtctacgcatgagtcagattagtcgtccacctttagtgggtcagaaaccggtgcgaaagc |
3418511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 16893951 - 16894047
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||| ||| ||||| |||||||||||||||| |||| || ||||||||| ||||||| ||| |||||||| | ||| |||||||||||||||||| |
|
|
| T |
16893951 |
cgattcacagggggaataacgcttggccagtacacatgcctttacgcatgagccggatt-gtcgcccacctttggt-ggtcggaaaccggtgcgaaagc |
16894047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 26 - 92
Target Start/End: Original strand, 22958791 - 22958857
Alignment:
| Q |
26 |
cagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttg |
92 |
Q |
| |
|
|||||||||||| |||||| |||| ||||||||||| |||||| |||||||| |||| |||||||| |
|
|
| T |
22958791 |
cagagggaacaatgcttggtcagtgtgcatgtctctatgcatgagccggattagtcgtccacctttg |
22958857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 24837256 - 24837354
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||| | |||||||||||||||||| |||| ||||| ||| || | |||||| |||| |||||||| ||| | |||||| ||||||||||| |
|
|
| T |
24837256 |
cgattcccagggagaacaacgcttggccagtgttcatgcctctaagcacgagcaggattagtcgtccacctttggtggatcggaaactggtgcgaaagc |
24837354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 36662429 - 36662515
Alignment:
| Q |
30 |
gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
|||||||| ||| |||||| |||||| ||||||| ||||||||||||| |||| ||| ||| |||| | |||||||| |||||||| |
|
|
| T |
36662429 |
gggaacaatacttagccagtgcgcatgcctctacgtatgaaccggattagtcgtccacttttaatggatcggaaaccgatgcgaaag |
36662515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 36 - 117
Target Start/End: Original strand, 3692864 - 3692945
Alignment:
| Q |
36 |
aacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||| |||| |||| ||||| |||||||||||| ||| |||||||||||||||||| | ||| | |||||||| ||||||| |
|
|
| T |
3692864 |
aacgtttggtcagtgcgcatacctctacgcatgagccgaattaatcgttcacctttggtaggtcgaaaaccggtacgaaagc |
3692945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 30 - 111
Target Start/End: Original strand, 11785940 - 11786021
Alignment:
| Q |
30 |
gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgc |
111 |
Q |
| |
|
|||| ||||| |||| |||| ||||| |||||||||||| || ||||||||| ||| ||||||||| | |||||||||||| |
|
|
| T |
11785940 |
gggagcaacgtttgggcagtgtgcatgcctctacgcatgagccagattaatcgctcatctttgatggatcggaaaccggtgc |
11786021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 19 - 78
Target Start/End: Original strand, 6042835 - 6042894
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggatta |
78 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||| || |||||||| |||||||| |
|
|
| T |
6042835 |
cgattcccaaggggaacaacgcttggccagtgcgcatgcctaaacgcatgagccggatta |
6042894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 30 - 117
Target Start/End: Original strand, 14846600 - 14846687
Alignment:
| Q |
30 |
gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||| | |||| |||| |||||| |||||||||||| | ||| | |||| |||||||| ||||| ||||| |||||||||||| |
|
|
| T |
14846600 |
gggaacaatgattggtcagtgcgcatgcctctacgcatgagtcagataagtcgtccacctttggtgggtcggaaatcggtgcgaaagc |
14846687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 31 - 117
Target Start/End: Complemental strand, 22212600 - 22212513
Alignment:
| Q |
31 |
ggaacaacgcttgg-ccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||||| | |||||||||||| |||||||| | |||||||| ||| ||||||||| ||| | | |||||||||||||||| |
|
|
| T |
22212600 |
ggaacaacgctttgaccagtacgcatgcttctacgcacgggccggattagtcgctcacctttggtggttcgaaaaccggtgcgaaagc |
22212513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 14666167 - 14666069
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||| || |||||| |||||||||| |||||| ||||||||| | || ||||| ||| ||| ||| ||||| | |||||||||||||||| |
|
|
| T |
14666167 |
cgattcccaggggaaacaacacttggccagtgcgcatgcctctacgcacaagccagattagtcgcccacagttggtgggtcgaaaaccggtgcgaaagc |
14666069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 27975905 - 27976003
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||||||| |||||||| |||| |||| ||||| |||||||| ||| |||||||||||| ||||||| ||||| | ||||| ||||||||| |
|
|
| T |
27975905 |
cgattcccagaaggaacaacacttgatcagtgtgcatgcctctacgcttgagccggattaatcgcccacctttagtgggtcaggaaccgatgcgaaagc |
27976003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 28033174 - 28033272
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||||||| |||||||| |||| |||| ||||| |||||||| ||| |||||||||||| ||||||| ||||| | ||||| ||||||||| |
|
|
| T |
28033174 |
cgattcccagaaggaacaacacttgatcagtgtgcatgcctctacgcttgagccggattaatcgcccacctttagtgggtcaggaaccgatgcgaaagc |
28033272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 8797 - 8699
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||| |||||||||||||||||||| ||| || |||||||||||| | |||||| |||| |||||||| ||||| |||||| ||||||||||| |
|
|
| T |
8797 |
cgattcccagggggaacaacgcttggccagtgcgcttgcctctacgcatgagctggattagtcgtccacctttggtgggtcggaaactggtgcgaaagc |
8699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 55; Significance: 1e-22; HSPs: 57)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 5855533 - 5855631
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |||||| |||||||||||| ||||||| |||||||||||| ||||| |||||||| ||||||||| |
|
|
| T |
5855533 |
cgattcccaggaggaacaacgcttggccagtgcgcatgcctctacgcatgaggcggattagtcgttcacctttagtgggtcggaaaccgatgcgaaagc |
5855631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 17642101 - 17642003
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||| ||||||||| |||||||||| |||||| ||||||||| || |||||||| |||| |||||||| ||||| |||||| ||||||||||| |
|
|
| T |
17642101 |
cgattcccagggggaacaacacttggccagtgcgcatgcctctacgcacgagccggattagtcgtccacctttggtgggtcggaaactggtgcgaaagc |
17642003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 18915878 - 18915976
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||| ||||||||| |||||||||| ||||| ||||||||| || |||||||| ||| ||||| ||| |||||||||||||||||||||||| |
|
|
| T |
18915878 |
cgattcccagggggaacaacacttggccagtgtgcatgcctctacgcacgagccggattagtcgctcaccattggtgggttggaaaccggtgcgaaagc |
18915976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 26325823 - 26325921
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||| ||||||||| ||||| |||| |||||| |||||||||||| |||||||| |||| |||| ||| ||||| |||||||||||||||||| |
|
|
| T |
26325823 |
cgattcccagcgggaacaacacttggtcagtgcgcatgcctctacgcatgagccggattagtcgtccaccattggtgggtcggaaaccggtgcgaaagc |
26325921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 49078125 - 49078223
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||| || |||||| |||||||||| |||||| |||||||||||| |||||||| ||||||||| ||| | ||| |||||||||||||||||| |
|
|
| T |
49078125 |
cgattcccaggggaaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgttcaccattggtaggtcggaaaccggtgcgaaagc |
49078223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 30 - 106
Target Start/End: Complemental strand, 14254354 - 14254278
Alignment:
| Q |
30 |
gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaacc |
106 |
Q |
| |
|
||||||||||||||||||||||||||| || ||||||||| |||||||| |||| |||||||||||||| ||||||| |
|
|
| T |
14254354 |
gggaacaacgcttggccagtacgcatgcctttacgcatgagccggattagtcgtccacctttgatgggtcggaaacc |
14254278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 22 - 117
Target Start/End: Original strand, 8764005 - 8764100
Alignment:
| Q |
22 |
ttcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||| ||||||||| |||||||||| |||||| ||||||||| || |||||||| |||| |||| ||| ||||| |||||||||||||||||| |
|
|
| T |
8764005 |
ttcccagggggaacaacacttggccagtgcgcatgcctctacgcacgagccggattagtcgtccaccgttggtgggtcggaaaccggtgcgaaagc |
8764100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 33 - 116
Target Start/End: Original strand, 14357780 - 14357863
Alignment:
| Q |
33 |
aacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
||||||| ||| ||||| |||||| ||||||||| ||||||||||||||||| ||| ||||||||| ||||||||||||||||| |
|
|
| T |
14357780 |
aacaacgtttgaccagtgcgcatgcctctacgcacgaaccggattaatcgtttaccattgatgggtcggaaaccggtgcgaaag |
14357863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 9659275 - 9659178
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||| |||||||||| ||| | ||| |||||| || ||||||||| |||||||| |||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
9659275 |
cgattcccag-gggaacaacgtttgactagtgcgcatgcctttacgcatgagccggattagtcgtccacctttggtgggttggaaaccggtgcgaaagc |
9659178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 41663953 - 41663855
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||| ||||||||| ||||| |||| |||||| |||||||||||| | |||||| |||| |||| ||| ||||| |||||||||||||||||| |
|
|
| T |
41663953 |
cgattcccagggggaacaacacttggtcagtgcgcatgcctctacgcatgagctggattagtcgtccaccattggtgggtcggaaaccggtgcgaaagc |
41663855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 31 - 117
Target Start/End: Complemental strand, 45361967 - 45361881
Alignment:
| Q |
31 |
ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||||||||||||||| |||||| | |||||||| | |||||||| |||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
45361967 |
ggaacaacgcttggccagtgcgcatgccactacgcataagccggattagtcgttcacctttagtgggtcggaaaccggtgcgaaagc |
45361881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 32 - 117
Target Start/End: Complemental strand, 10173055 - 10172970
Alignment:
| Q |
32 |
gaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||||||||||| | |||| |||||||||||| |||||||| ||| |||||||| ||||| |||||||||||||||||| |
|
|
| T |
10173055 |
gaacaacgcttggccagtgcccatgcctctacgcatgagccggattactcgcccacctttggtgggtcggaaaccggtgcgaaagc |
10172970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 21 - 117
Target Start/End: Complemental strand, 43959916 - 43959820
Alignment:
| Q |
21 |
attcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||||| ||||||||| || |||||||| ||| ||||||| ||| | |||||||||||||||||| |
|
|
| T |
43959916 |
attcccagggggaacaacgcttggccagtgcgcatgcctctacgcacgagccggattagtcgcccacctttagtggatcggaaaccggtgcgaaagc |
43959820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 30 - 117
Target Start/End: Complemental strand, 32142932 - 32142845
Alignment:
| Q |
30 |
gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||||| |||||||||| |||||| || ||||||||| ||| |||| ||| ||||||||||||||| |||||||| ||||||||| |
|
|
| T |
32142932 |
gggaacaacacttggccagtgcgcatgcctttacgcatgagccgaattagtcgctcacctttgatgggtcggaaaccgatgcgaaagc |
32142845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 34 - 117
Target Start/End: Original strand, 37339846 - 37339929
Alignment:
| Q |
34 |
acaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||||||||| |||||| ||| ||||| || |||||||| ||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
37339846 |
acaacgcttggccagtgcgcatgcctcaacgcacgagccggattagtcgcccacctttggtgggttggaaaccggtgcgaaagc |
37339929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 30 - 96
Target Start/End: Original strand, 10336538 - 10336604
Alignment:
| Q |
30 |
gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgg |
96 |
Q |
| |
|
|||||||||||||| ||||| |||||| |||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
10336538 |
gggaacaacgcttgaccagtgcgcatgcctctacgcatgagccggattaatcgtccacctttgatgg |
10336604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 31 - 117
Target Start/End: Original strand, 10422811 - 10422897
Alignment:
| Q |
31 |
ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||| |||||||||| |||||| |||||||||||| |||||||| |||| |||||||| | || |||||||||||||||||| |
|
|
| T |
10422811 |
ggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgtccacctttggtaagtcggaaaccggtgcgaaagc |
10422897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 30927824 - 30927726
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||| ||||||||||||||||||||||| | ||||| |||||||||||| |||||||| |||| ||| |||| ||||| ||||||||||| ||||| |
|
|
| T |
30927824 |
cgatttccagagggaacaacgcttggccaatgtgcatgcctctacgcatgagccggattagtcgtccacttttggtgggtcagaaaccggtgcaaaagc |
30927726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 31 - 116
Target Start/End: Original strand, 16263568 - 16263653
Alignment:
| Q |
31 |
ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||||| | ||||| || |||| ||| |||||||| | ||||||||||||||||| |
|
|
| T |
16263568 |
ggaacaacgcttggccagtgcgcatgcctctacgcataagccggaatagtcgtccacttttgatggatcggaaaccggtgcgaaag |
16263653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 30 - 117
Target Start/End: Original strand, 34697357 - 34697444
Alignment:
| Q |
30 |
gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||||| |||||| ||| ||||| |||||||||||| |||||||| ||| ||| ||||||||||||||||||| ||||||||| |
|
|
| T |
34697357 |
gggaacaacacttggctagtgtgcatgcctctacgcatgagccggattagtcgcccacttttgatgggttggaaaccgatgcgaaagc |
34697444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 15238203 - 15238105
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||| |||| ||||||||||||| | ||||| ||||||||| ||| | |||| ||| ||||||||| |||||||||||||||| ||||||| |
|
|
| T |
15238203 |
cgattcccagggggagcaacgcttggccaatgagcatgcctctacgcacgaatcatattagtcgctcacctttggtgggttggaaaccggttcgaaagc |
15238105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 35 - 117
Target Start/End: Complemental strand, 33498920 - 33498838
Alignment:
| Q |
35 |
caacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||||||||||| |||||| |||||||||||| |||||||| |||| |||||||||||| | | ||| |||| ||||||| |
|
|
| T |
33498920 |
caacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgtccacctttgatggatcgtaaagcggtacgaaagc |
33498838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 35211269 - 35211171
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||| ||||| ||||||| |||| |||| |||||||| |||||||||||| | | |||| |||| |||||||| ||||| ||||||||||| |||||| |
|
|
| T |
35211269 |
cgatttccagaaggaacaatgcttagccaatacgcatgcctctacgcatgagctgaattagtcgtccacctttggtgggtcggaaaccggtgtgaaagc |
35211171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 40 - 117
Target Start/End: Complemental strand, 4581758 - 4581681
Alignment:
| Q |
40 |
cttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||| |||||| ||||||||| || ||||| || |||| |||||||| ||||| |||||||||||||||||| |
|
|
| T |
4581758 |
cttggccagtgcgcatgcctctacgcacgagccggaatagtcgtccacctttggtgggtcggaaaccggtgcgaaagc |
4581681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 33 - 116
Target Start/End: Original strand, 5504056 - 5504139
Alignment:
| Q |
33 |
aacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
||||||||||| ||| | |||| |||||||||||| |||||||| |||| |||||||||||||| |||||||||| |||||| |
|
|
| T |
5504056 |
aacaacgcttgattagtgcacatgcctctacgcatgagccggattagtcgtccacctttgatgggtcggaaaccggtacgaaag |
5504139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 30 - 117
Target Start/End: Complemental strand, 11397975 - 11397888
Alignment:
| Q |
30 |
gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||| ||||||| | || ||| |||||||||||| ||||||| |||| |||||||| ||||| ||||| |||||||||||| |
|
|
| T |
11397975 |
gggaacaacgtttggccaatgcgtatgcctctacgcatgagtcggattagtcgtccacctttggtgggtcggaaatcggtgcgaaagc |
11397888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 46 - 117
Target Start/End: Original strand, 26660176 - 26660246
Alignment:
| Q |
46 |
cagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||||||| |||||||||||| |||||||| ||| |||||||| ||||| |||||||||||||||||| |
|
|
| T |
26660176 |
cagtacgcatgcctctacgcatgagccggattagtcg-ccacctttggtgggtcggaaaccggtgcgaaagc |
26660246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 41 - 116
Target Start/End: Complemental strand, 45726508 - 45726433
Alignment:
| Q |
41 |
ttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
||||||||| || |||||||||||||||| |||||||| ||||||||||||| ||| | ||| || |||||||||| |
|
|
| T |
45726508 |
ttggccagtgcgtatgtctctacgcatgagccggattagtcgttcacctttggtggatcggagactggtgcgaaag |
45726433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 20 - 117
Target Start/End: Complemental strand, 12036840 - 12036742
Alignment:
| Q |
20 |
gattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttgg-aaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||| || |||||||| ||||||||||| |||||| ||||||||| || || |||||||||| |||||||| ||| | || ||||| |||||||||| |
|
|
| T |
12036840 |
gattcctagggggaacaatgcttggccagtgcgcatgcctctacgcacgagccagattaatcgtccacctttggtggatcggaaaaccagtgcgaaagc |
12036742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 30 - 116
Target Start/End: Complemental strand, 18649438 - 18649352
Alignment:
| Q |
30 |
gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
|||||||||||||| ||||| |||||| ||||||| | || || ||||||||| ||||||| ||| ||||||||||||||||||| |
|
|
| T |
18649438 |
gggaacaacgcttgaccagtgcgcatgcctctacgtacgagccagattaatcgcccacctttagtggattggaaaccggtgcgaaag |
18649352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 32151019 - 32150921
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||| |||| ||||||||| |||| |||| |||||| || ||||||||| ||| |||| ||| ||||||||||||||| | |||||| ||||||||| |
|
|
| T |
32151019 |
cgatttccagggggaacaacatttggtcagtgcgcatgcctttacgcatgagccgaattagtcgctcacctttgatgggtcgaaaaccgatgcgaaagc |
32150921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 34719787 - 34719885
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||||| ||||| |||||||| ||||| |||||| ||||||||| || | ||||| ||| ||||||||| ||||| |||||| ||||||||||| |
|
|
| T |
34719787 |
cgattcccactgggaataacgcttgaccagtgcgcatgcctctacgcacgagtcagattagtcgctcacctttggtgggtcggaaactggtgcgaaagc |
34719885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 19 - 116
Target Start/End: Complemental strand, 21849301 - 21849205
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
|||||||||| |||||||||||||||| ||| |||||| ||||||||| || |||||||| ||| |||| ||| ||||| | |||||||| |||||| |
|
|
| T |
21849301 |
cgattcccag-gggaacaacgcttggctagtgcgcatgcctctacgcacgagccggattagtcgctcactattggtgggtcgaaaaccggtacgaaag |
21849205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 32 - 116
Target Start/End: Complemental strand, 50371918 - 50371834
Alignment:
| Q |
32 |
gaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| | |||||||| ||| || ||||| ||| | ||||||||||||||||| |
|
|
| T |
50371918 |
gaacaacgcttggccagtacgcatgcttctacgcacaagccggattagtcgcccatctttggtggatcggaaaccggtgcgaaag |
50371834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 30 - 117
Target Start/End: Complemental strand, 5143239 - 5143153
Alignment:
| Q |
30 |
gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||||||||||| ||||||||||| ||||||||| | ||||||| ||| ||||||||||||| | | ||||||||| |||||| |
|
|
| T |
5143239 |
gggaacaacgcttggtcagtacgcatgcctctacgca-cagacggattagtcgctcacctttgatggatcgaaaaccggtgtgaaagc |
5143153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 33 - 116
Target Start/End: Original strand, 19195391 - 19195469
Alignment:
| Q |
33 |
aacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
||||||| ||||||||| |||||| |||||||||||| ||| ||||| ||||||||||| || ||||||||||||||||| |
|
|
| T |
19195391 |
aacaacgtttggccagtgcgcatgcctctacgcatgagccg-----atcgtccacctttgatgagtcggaaaccggtgcgaaag |
19195469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 19 - 106
Target Start/End: Complemental strand, 33418212 - 33418125
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaacc |
106 |
Q |
| |
|
||||||| || ||| |||||||||||||||| |||||| ||||| ||| || |||||||| |||| |||||||| | ||| ||||||| |
|
|
| T |
33418212 |
cgattcctaggggggacaacgcttggccagtgcgcatgcctctatgcacgagccggattagtcgtccacctttggtcggtcggaaacc |
33418125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 30 - 117
Target Start/End: Original strand, 50094926 - 50095013
Alignment:
| Q |
30 |
gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||| ||| |||||||||||| ||||||||||| ||||||| |||| |||| || ||||| |||||||||||| ||||| |
|
|
| T |
50094926 |
gggaacaacgtttgaccagtacgcatgcttctacgcatgagtcggattagtcgtccaccattagtgggtcggaaaccggtgcaaaagc |
50095013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 32882 - 32980
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||| |||||||||||||| |||| | |||| |||||||||||| ||| |||| |||| || |||||||| | |||||||| | ||||||| |
|
|
| T |
32882 |
cgattcccaggaggaacaacgcttggtcagtgcacatgcctctacgcatgagccgaattagtcgtctacttttgatggatcggaaaccgatacgaaagc |
32980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 2981028 - 2980930
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||| ||||||||| |||||||||| ||||| ||||||||| || ||||||| |||| || ||| ||||| ||||| |||||||||||| |
|
|
| T |
2981028 |
cgattcccagcgggaacaacacttggccagtgtgcatgcctctacgcacgagtcggattagtcgtccatgtttagtgggtcggaaatcggtgcgaaagc |
2980930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 39 - 117
Target Start/End: Complemental strand, 18708617 - 18708539
Alignment:
| Q |
39 |
gcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||| ||| |||||| |||||| ||||| || ||||| ||| ||||||||||||||||| |||||| ||| ||||| |
|
|
| T |
18708617 |
gcttggctagtgcgcatgcctctacacatgagccagattagtcgctcacctttgatgggttgaaaaccgatgctaaagc |
18708539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 34 - 116
Target Start/End: Original strand, 26258721 - 26258803
Alignment:
| Q |
34 |
acaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
||||||||||| |||| | |||| || ||||||||| |||||||||||| ||||||| |||||||||||| ||||| |||| |
|
|
| T |
26258721 |
acaacgcttggtcagtgcacatgcctttacgcatgagtcggattaatcgtccacctttagtgggttggaaactggtgcaaaag |
26258803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 32 - 117
Target Start/End: Original strand, 44969688 - 44969773
Alignment:
| Q |
32 |
gaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||||||||||| ||||| | |||||||||| |||||||| |||| || | ||| ||| | ||||||||||| |||||| |
|
|
| T |
44969688 |
gaacaacgcttggccagtgtgcatgcccctacgcatgagccggattagtcgtccatcattggtggatcggaaaccggtgtgaaagc |
44969773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 32 - 117
Target Start/End: Complemental strand, 46929822 - 46929737
Alignment:
| Q |
32 |
gaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||||||||| | |||||| ||| || ||||| |||||||| |||| ||| |||||||| | | |||||| ||||||||| |
|
|
| T |
46929822 |
gaacaacgcttggccaatgcgcatgcctccacacatgagccggattagtcgtccacttttgatggatcgaaaaccgatgcgaaagc |
46929737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 21 - 117
Target Start/End: Original strand, 18808278 - 18808374
Alignment:
| Q |
21 |
attcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||| |||||||||||||||||| ||||| |||||| || || | |||| |||||||| ||| | |||| ||||| |||||||||||||||||| |
|
|
| T |
18808278 |
attctcagagggaacaacgcttgaccagtgcgcatgcctttatgtatgagccggattattcgactaactttattgggtcggaaaccggtgcgaaagc |
18808374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 19 - 66
Target Start/End: Original strand, 6563452 - 6563499
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgca |
66 |
Q |
| |
|
||||||| || |||||||||||||||||||| | |||||||||||||| |
|
|
| T |
6563452 |
cgattcctagggggaacaacgcttggccagtgcacatgtctctacgca |
6563499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 30 - 117
Target Start/End: Complemental strand, 12744609 - 12744522
Alignment:
| Q |
30 |
gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||||||| | ||| ||||||||||||||||||| ||| |||| ||| |||| ||| ||||| ||||| | ||||||||| |
|
|
| T |
12744609 |
gggaacaacgcttgactagtgcgcatgtctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagatgcgaaagc |
12744522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 30 - 117
Target Start/End: Complemental strand, 12755599 - 12755512
Alignment:
| Q |
30 |
gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||||||| | ||| ||||||||||||||||||| ||| |||| ||| |||| ||| ||||| ||||| | ||||||||| |
|
|
| T |
12755599 |
gggaacaacgcttgactagtgcgcatgtctctacgcatgagccgaattagtcgctcactgttggtgggtcagaaacagatgcgaaagc |
12755512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 19 - 78
Target Start/End: Complemental strand, 48798167 - 48798108
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggatta |
78 |
Q |
| |
|
||||| |||| |||||||||||||| | ||| |||||| |||||||||||| |||||||| |
|
|
| T |
48798167 |
cgatttccagggggaacaacgcttgactagtgcgcatgcctctacgcatgagccggatta |
48798108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 15465976 - 15466074
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||| |||| ||||||||||||||| |||| | |||| ||||||||| || | |||| ||| ||||||||| ||||| |||||||| | ||||||| |
|
|
| T |
15465976 |
cgatttccagggggaacaacgcttggtcagtgcacatgcctctacgcacgagtctgattggtcgctcacctttggtgggtcggaaaccgatacgaaagc |
15466074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 33 - 83
Target Start/End: Complemental strand, 17988743 - 17988693
Alignment:
| Q |
33 |
aacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgt |
83 |
Q |
| |
|
||||| ||||||||||| ||||| ||||||||||||||||||||| |||| |
|
|
| T |
17988743 |
aacaatgcttggccagtgcgcatacctctacgcatgaaccggattagtcgt |
17988693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 63 - 117
Target Start/End: Original strand, 51437512 - 51437566
Alignment:
| Q |
63 |
cgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||| |||||||| || | |||||||| ||||| |||||||||||||||||| |
|
|
| T |
51437512 |
cgcatgagccggattagtcatccacctttggtgggtcggaaaccggtgcgaaagc |
51437566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 63 - 116
Target Start/End: Complemental strand, 8905216 - 8905163
Alignment:
| Q |
63 |
cgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
||||||| || ||||||||| |||||||||| ||| ||||||||||||||||| |
|
|
| T |
8905216 |
cgcatgagccagattaatcgaccacctttgattggtcggaaaccggtgcgaaag |
8905163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 20 - 117
Target Start/End: Original strand, 28416958 - 28417055
Alignment:
| Q |
20 |
gattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||| |||||||||||||| |||||||| |||||| |||||||| ||||| ||||| | | |||| ||||||| | | ||||||||| |||||| |
|
|
| T |
28416958 |
gattctcagagggaacaacgtttggccagggcgcatgcatctacgcacgaacccgattagttgctcactattgatggatcgaaaaccggtgtgaaagc |
28417055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 19 - 116
Target Start/End: Complemental strand, 31576644 - 31576547
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
|||||| ||| || ||||| ||||||||| | || || |||||||||||| |||| ||| |||| || |||||||| || |||||||||||| |||| |
|
|
| T |
31576644 |
cgattctcaggggaaacaatgcttggccaatgcgtgtgcctctacgcatgagccggcttagtcgtccatctttgatgtgtcggaaaccggtgcaaaag |
31576547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 19 - 116
Target Start/End: Complemental strand, 33004112 - 33004015
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
||||| |||| || ||||| ||||||||||| |||||| ||||||||| || |||||||| || |||| || ||||| | ||||||||||||||| |
|
|
| T |
33004112 |
cgatttccaggggaaacaatgcttggccagtgcgcatgcctctacgcacgagccggattagtcacccaccaatggtgggtcgaaaaccggtgcgaaag |
33004015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 85 - 117
Target Start/End: Original strand, 40702591 - 40702623
Alignment:
| Q |
85 |
cacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |
|
|
| T |
40702591 |
cacctttgatgggtcggaaaccggtgcgaaagc |
40702623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 30 - 117
Target Start/End: Complemental strand, 65237 - 65150
Alignment:
| Q |
30 |
gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| | |||||| ||| |||| |||||| | | |||||||||||||||||| |
|
|
| T |
65237 |
gggaacaacgcttggccagtgcgcatgtctctacgcatgagctggattagtcgctcacttttgatagatcggaaaccggtgcgaaagc |
65150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0010 (Bit Score: 51; Significance: 3e-20; HSPs: 2)
Name: scaffold0010
Description:
Target: scaffold0010; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 155807 - 155709
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||| |||||||||||||||| ||| |||||| ||||||||| || |||||||| ||| |||||||| ||||| |||| ||||||||||||| |
|
|
| T |
155807 |
cgattcccagggggaacaacgcttggctagtgcgcatgcctctacgcacgagccggattagtcgcccacctttggtgggtcggaagccggtgcgaaagc |
155709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0010; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 19 - 115
Target Start/End: Complemental strand, 25880 - 25784
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaa |
115 |
Q |
| |
|
||||||| || | |||||||||||||||||| |||||| |||||||| |||||| ||||| || ||||||| ||||| ||||||||||||||| |
|
|
| T |
25880 |
cgattcctagggagaacaacgcttggccagtgcgcatgactctacgcgtgaaccagattagtcacccacctttactgggtcagaaaccggtgcgaaa |
25784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0376 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: scaffold0376
Description:
Target: scaffold0376; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 31 - 116
Target Start/End: Original strand, 12695 - 12780
Alignment:
| Q |
31 |
ggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||| ||||||||||| ||| |||||||||||||| |||||||||||||||| |
|
|
| T |
12695 |
ggaacaacgcttggccagtgtgcatgcctctacgcacgaaccggattagtcgcccacctttgatgggtcagaaaccggtgcgaaag |
12780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0209 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: scaffold0209
Description:
Target: scaffold0209; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 29 - 117
Target Start/End: Original strand, 12596 - 12684
Alignment:
| Q |
29 |
agggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||||||||||| ||||| |||||| |||||||||||| ||||||| ||| |||||||||||| || ||||||||||||||||| |
|
|
| T |
12596 |
agggaacaacgcttgaccagtgcgcatgcctctacgcatgagtcggattagtcgcccacctttgatggattagaaaccggtgcgaaagc |
12684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0223 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: scaffold0223
Description:
Target: scaffold0223; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 33 - 116
Target Start/End: Original strand, 16906 - 16989
Alignment:
| Q |
33 |
aacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
|||||||||||| |||| || ||||||||||||| || || ||||| ||| ||||||||| |||||||||||||| |||||||| |
|
|
| T |
16906 |
aacaacgcttggtcagtgcgtatgtctctacgcacgagccagattagtcgctcacctttggtgggttggaaaccgatgcgaaag |
16989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0170 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: scaffold0170
Description:
Target: scaffold0170; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 19 - 98
Target Start/End: Original strand, 9858 - 9937
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggt |
98 |
Q |
| |
|
||||| |||| |||||||||||||||||||| |||||| ||||||||| || |||||||| |||| |||||||| ||||| |
|
|
| T |
9858 |
cgatttccagggggaacaacgcttggccagtgcgcatgcctctacgcacgagccggattagtcgtccacctttggtgggt |
9937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 44; Significance: 4e-16; HSPs: 2)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 30 - 117
Target Start/End: Original strand, 319446 - 319533
Alignment:
| Q |
30 |
gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||| |||||| | |||||| |||| |||||||| |||| |||||||||||||||||| |
|
|
| T |
319446 |
gggaacaacgcttggccagtgcgcatccctctatgcatgagctggattagtcgtccacctttggtggggcggaaaccggtgcgaaagc |
319533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 19 - 117
Target Start/End: Original strand, 583 - 681
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
|||||| ||| ||||||||| |||| |||| ||||| ||||||| |||| || ||||| ||| ||||||||| ||||| |||||||||||||||||| |
|
|
| T |
583 |
cgattcgcagggggaacaacacttgatcagtgtgcatgcctctacgtatgagccagattagtcgctcacctttggtgggtcggaaaccggtgcgaaagc |
681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0041 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: scaffold0041
Description:
Target: scaffold0041; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 30 - 116
Target Start/End: Original strand, 25109 - 25195
Alignment:
| Q |
30 |
gggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
||||||||| |||| |||| ||||||| |||||||||||| | |||||||||| |||||||| ||| | ||||||||||||||||| |
|
|
| T |
25109 |
gggaacaacatttggacagtgcgcatgtttctacgcatgaatcagattaatcgtccacctttggtggatcggaaaccggtgcgaaag |
25195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0086 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: scaffold0086
Description:
Target: scaffold0086; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 19 - 116
Target Start/End: Original strand, 26196 - 26293
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
||||| |||| |||||||||||||||||||| ||||| ||||||||| || |||||||| |||| ||| |||||| || ||||||| ||||||||| |
|
|
| T |
26196 |
cgatttccagggggaacaacgcttggccagtgtgcatgcctctacgcacgagccggattagtcgtccacaattgatgagtcggaaaccagtgcgaaag |
26293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 19 - 116
Target Start/End: Complemental strand, 42928 - 42831
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
||||||| || | |||||| |||||| |||| |||||| |||||| ||||| |||||||| ||| |||||||| ||||| ||||||||||||||||| |
|
|
| T |
42928 |
cgattcctagggagaacaatgcttggtcagtgcgcatgcctctacacatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag |
42831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0316 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold0316
Description:
Target: scaffold0316; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 19 - 117
Target Start/End: Complemental strand, 1710 - 1612
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||| |||| |||||||||| || |||||| |||||| |||||||||||| || |||| ||| |||||||| ||||| | |||||||||||||||| |
|
|
| T |
1710 |
cgatttccagggggaacaacgattagccagtgcgcatgcctctacgcatgagccaaattagtcgcccacctttggtgggtcgaaaaccggtgcgaaagc |
1612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0013 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: scaffold0013
Description:
Target: scaffold0013; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 19 - 59
Target Start/End: Original strand, 51744 - 51784
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtct |
59 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
51744 |
cgattcccagagggaacaacgcttggccagtgcgcatgtct |
51784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0006 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: scaffold0006
Description:
Target: scaffold0006; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 19 - 113
Target Start/End: Original strand, 68530 - 68621
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcga |
113 |
Q |
| |
|
|||||||||| ||||||||||||||| || |||||| ||||||||| || |||||||| ||| |||||||| ||||| | |||||||||||| |
|
|
| T |
68530 |
cgattcccagggggaacaacgcttgg---gtgcgcatgcctctacgcacgagccggattagtcgcccacctttggtgggtcgaaaaccggtgcga |
68621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 37; Significance: 0.000000000006; HSPs: 3)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 41 - 117
Target Start/End: Original strand, 219404 - 219480
Alignment:
| Q |
41 |
ttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaagc |
117 |
Q |
| |
|
||||||||| |||||| ||||||||| |||| |||||| |||| |||||||||||| | | |||||||||| ||||| |
|
|
| T |
219404 |
ttggccagtgcgcatgcctctacgcacgaactggattagtcgtccacctttgatggatcgaaaaccggtgcaaaagc |
219480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 41 - 116
Target Start/End: Complemental strand, 250099 - 250024
Alignment:
| Q |
41 |
ttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
||||||||| |||||| ||||||||| || |||||||| ||| || |||||| ||||| ||||| ||||||||||| |
|
|
| T |
250099 |
ttggccagtgcgcatgcctctacgcacgagccggattagtcgctcgcctttggtgggtcggaaatcggtgcgaaag |
250024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 19 - 66
Target Start/End: Complemental strand, 271170 - 271123
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgca |
66 |
Q |
| |
|
|||||||||| ||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
271170 |
cgattcccagggggaacaacgcttggtcagtgcgcatgtctctacgca |
271123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0341 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: scaffold0341
Description:
Target: scaffold0341; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 19 - 66
Target Start/End: Original strand, 18645 - 18692
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctacgca |
66 |
Q |
| |
|
||||||| || |||||||||||||||||||| | |||||||||||||| |
|
|
| T |
18645 |
cgattcctagggggaacaacgcttggccagtgcacatgtctctacgca |
18692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 58 - 116
Target Start/End: Original strand, 224369 - 224427
Alignment:
| Q |
58 |
ctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccggtgcgaaag |
116 |
Q |
| |
|
||||||||| || |||||||| |||| || ||||| ||||| ||||||||||||||||| |
|
|
| T |
224369 |
ctctacgcacgagccggattagtcgtccatctttggtgggtcggaaaccggtgcgaaag |
224427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0384 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: scaffold0384
Description:
Target: scaffold0384; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 34 - 107
Target Start/End: Original strand, 6000 - 6073
Alignment:
| Q |
34 |
acaacgcttggccagtacgcatgtctctacgcatgaaccggattaatcgttcacctttgatgggttggaaaccg |
107 |
Q |
| |
|
|||||||||||||||| | |||| |||||||||||| || |||| |||| |||| ||| ||||| |||||||| |
|
|
| T |
6000 |
acaacgcttggccagtgcacatgcctctacgcatgagacgaattagtcgtccaccattggtgggtcggaaaccg |
6073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0079 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0079
Description:
Target: scaffold0079; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 63
Target Start/End: Original strand, 8188 - 8231
Alignment:
| Q |
19 |
cgattcccagagggaacaacgcttggccagtacgcatgtctctac |
63 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |||||| |||||| |
|
|
| T |
8188 |
cgattccca-agggaacaacgcttggccagtgcgcatgcctctac |
8231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University