View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2470_low_8 (Length: 250)
Name: NF2470_low_8
Description: NF2470
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2470_low_8 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 29441157 - 29440920
Alignment:
| Q |
1 |
aatctatcagatgaagatcttgagttaattctcagatgttttctacaattaaagtggttgatcctatcagataacaatttcttgaccattcctgattgca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29441157 |
aatctatcagatgaagatcttgagttaattctcaaatgttttctacaattaaagtggttgatcctatcagataacaatttcttgaccattcctgtgtgca |
29441058 |
T |
 |
| Q |
101 |
ttgaagatctttctcatctcttgcttcttaacatagaaaactgcaagcatcttagagatatttcagtgcttccaccatatttgcaatatatagatgcaag |
200 |
Q |
| |
|
|| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29441057 |
ttaaagacctttctcatctcttgcttcttaacatagaaaactgcaagcatcttagagatatttcagtgcttccaccatatttgcaatatatagatgcaag |
29440958 |
T |
 |
| Q |
201 |
gaagtgtatggcattgactcctcattcatcagaagtat |
238 |
Q |
| |
|
|| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
29440957 |
gatgtgtatggctttgactcctcattcatcagaagtat |
29440920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University