View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2471_low_10 (Length: 217)
Name: NF2471_low_10
Description: NF2471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2471_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 30 - 199
Target Start/End: Complemental strand, 49380133 - 49379964
Alignment:
| Q |
30 |
tagcaagagaaaattaaatagataaccatggagcttttttgttattgtcttgtttatgttccattaggaagagtgctatggtttgcagtactcctttgct |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
49380133 |
tagcaagagaaaattaaatagataaccatggagcttttttgttattgtcttgtttatgttccattaggaagagtgctatggtttgcattactcctttgct |
49380034 |
T |
 |
| Q |
130 |
agttaagtgcaaggtaaacaaagatagtctaattaattatgagcaacatagtgaaaattgcgagtgtatt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49380033 |
agttaagtgcaaggtaaacaaagatagtctaattaattatgagcaacatagtgaaaattgcgagtgtatt |
49379964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University