View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2471_low_11 (Length: 210)
Name: NF2471_low_11
Description: NF2471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2471_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 16 - 193
Target Start/End: Complemental strand, 25746812 - 25746635
Alignment:
| Q |
16 |
cagaaactggatgacaaattgaatttggattcagaagggagaccgtttcggatgttggtatttaggggaagtccaaaatcaagtaaaaaatctattcgtt |
115 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
25746812 |
cagaaactggatgacaaactgaatttggattcagaagggagaccgtttcggatgttggtatttaggggaagtccaaaatcaagtaaaaagtctattcgtt |
25746713 |
T |
|
| Q |
116 |
atattgatcagctgcgagaagaagatgctgcagcacttcaaaacagttccaatcaacgtatccatcgaaggctgccta |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25746712 |
atattgatcagctgcgagaagaagatgctgcagcacttcaaaacagttccaatcaacgtatccatcgaaggctgccta |
25746635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University