View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2471_low_5 (Length: 262)
Name: NF2471_low_5
Description: NF2471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2471_low_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 20 - 251
Target Start/End: Original strand, 46138173 - 46138404
Alignment:
| Q |
20 |
ttgaaatttgtttataatttctattctatacgttcagaaaggnnnnnnncagtatgagtacattcataaccaaaggttgtttactctttctacaatttta |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46138173 |
ttgaaatttgtttataatttctattctatacgttcagaaaggaaaaaaacagtatcagtacattcataaccaaaggttgtttactctttctacaatttta |
46138272 |
T |
|
| Q |
120 |
tttttgatagttgctacatatgtaccatcaatatcatataataattcctcaaaaacaaatattatcatctaagattaattcaggacagaatgaaatcttt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46138273 |
tttttgatagttgctacatatgtaccatcaatatcatataataattcctcaaaaacaaatattatcatctaagattaattcaggacagaatgaaatcttt |
46138372 |
T |
|
| Q |
220 |
gattaggtcgttcaattgcttttgcttgatga |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
46138373 |
gattaggtcgttcaattgcttttgcttgatga |
46138404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University