View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2471_low_6 (Length: 250)
Name: NF2471_low_6
Description: NF2471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2471_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 49380226 - 49380468
Alignment:
| Q |
1 |
ccaaatggagctaattaacataccaactttctgcctcttagtggaggagtcaagggg-cttagattcaagactacatggattctttctttagaaacacaa |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49380226 |
ccaaatggagctaattaacataccaactttctgcctcttagtggaggagtcaagggggcttagattcaagactacatggattctttctttagaaacacaa |
49380325 |
T |
|
| Q |
100 |
agtgtgattagttagttattagtattaataaataaatgagttgaatacgtgtgtcatctgtctcctttgaatacttttcacttccattgttgacaaagtt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49380326 |
agtgtgattagttagttattagtattaataaataaatgagttgaatacgtgtgtcatctgtctcctttgaatacttttcacttccattgttgacaaagtt |
49380425 |
T |
|
| Q |
200 |
atgtgggtctaaaacaagttagcttaaatgctattttcatctc |
242 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49380426 |
atgcgggtctaaaacaagttagcttaaatgctattttcatctc |
49380468 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University