View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2471_low_8 (Length: 245)
Name: NF2471_low_8
Description: NF2471
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2471_low_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 143; Significance: 3e-75; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 13 - 180
Target Start/End: Complemental strand, 1118756 - 1118589
Alignment:
| Q |
13 |
atgaagtcaaaatggcaacataaatagttagaatggaagtgtaagggacaaaaataaaatcattttgagtaactgtatcagacaaattgaccaaaacgtc |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
1118756 |
atgaagtcaaaatggcaacataaatagttagaatggaagtgtaagggacaaaaataaaatcattttgcgtaactgtatcagacaaattgaccaaaacgtc |
1118657 |
T |
 |
| Q |
113 |
aacttccnnnnnnncaatgcaaaacaagtcaaattgaacttaaaagaagctcaaataaatataattgc |
180 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1118656 |
aacttccaaaaaaacaatgcaaaacaagtcaaattgaacttaaaagaagctcaaataaatataattgc |
1118589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 185 - 231
Target Start/End: Complemental strand, 1118278 - 1118232
Alignment:
| Q |
185 |
aaatacaaaaattagagtagattatcgaactaatttgccttaaagct |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
1118278 |
aaatacaaaaattagagtagattatcgaactaattttccttaaagct |
1118232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University