View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2472R-Insertion-11 (Length: 55)
Name: NF2472R-Insertion-11
Description: NF2472R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2472R-Insertion-11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 43; Significance: 2e-16; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 43; E-Value: 2e-16
Query Start/End: Original strand, 10 - 52
Target Start/End: Original strand, 42099637 - 42099679
Alignment:
| Q |
10 |
tggatccctttaatgatgaagagatttgacttcacatcacata |
52 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42099637 |
tggatccctttaatgatgaagagatttgacttcacatcacata |
42099679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University