View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2472R-Insertion-8 (Length: 173)

Name: NF2472R-Insertion-8
Description: NF2472R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2472R-Insertion-8
NF2472R-Insertion-8
[»] chr3 (1 HSPs)
chr3 (8-173)||(48949170-48949336)
[»] chr8 (1 HSPs)
chr8 (72-173)||(15247940-15248042)
[»] chr1 (1 HSPs)
chr1 (71-173)||(28024336-28024439)
[»] chr5 (1 HSPs)
chr5 (67-153)||(503721-503808)
[»] chr7 (1 HSPs)
chr7 (68-153)||(32274445-32274531)
[»] chr6 (1 HSPs)
chr6 (88-159)||(34785019-34785091)


Alignment Details
Target: chr3 (Bit Score: 143; Significance: 2e-75; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 143; E-Value: 2e-75
Query Start/End: Original strand, 8 - 173
Target Start/End: Complemental strand, 48949336 - 48949170
Alignment:
8 aaaaaggggggacattgtttattttatgcttaggggtgagaaacaccatgcatcaatttatttagtggttgtttggttctatggtgggagcacaaatatc 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |||| |||||||    
48949336 aaaaaggggggacattgtttattttatgcttaggggtgagaaacatcatgcatcaatttatttagtggttgtttggttctacggtggaagcataaatatc 48949237  T
108 acatcccaatgctcaactacc-tgatttttaagaagctcaaaatagtggctttgggcagaacgtgcg 173  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
48949236 acatcccaatgctcaactaccgtgatttttaagaagctcaaaatagtggctttgggcagaacgtgcg 48949170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 72 - 173
Target Start/End: Original strand, 15247940 - 15248042
Alignment:
72 gtggttgtttggttctatggtgggagcacaaatatcacatcccaatgctcaactacc-tgatttttaagaagctcaaaatagtggctttgggcagaacgt 170  Q
    |||| |||||||||   ||||||||||||||||||||  ||||||||||| || ||| ||||||||| |||||| ||||| |||||||| |||| |||||    
15247940 gtggctgtttggtttggtggtgggagcacaaatatcaggtcccaatgctccaccaccgtgatttttatgaagcttaaaattgtggctttaggcaaaacgt 15248039  T
171 gcg 173  Q
    |||    
15248040 gcg 15248042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 36; Significance: 0.00000000001; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 71 - 173
Target Start/End: Complemental strand, 28024439 - 28024336
Alignment:
71 agtggttgtttggttctatggtgggagcacaaatatcacatcccaatgctcaactacc-tgatttttaagaagctcaaaatagtggctttgggcagaacg 169  Q
    ||||| |||||||||   ||||||||||||||||||| | ||||||||||| ||| || ||||||||| |||||| ||||| |||| |||  ||| ||||    
28024439 agtggctgtttggtttggtggtgggagcacaaatatcgcgtcccaatgctccactgccgtgatttttatgaagcttaaaattgtggatttttgcaaaacg 28024340  T
170 tgcg 173  Q
    ||||    
28024339 tgcg 28024336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 67 - 153
Target Start/End: Complemental strand, 503808 - 503721
Alignment:
67 atttagtggttgtttggttctatggtgggagcacaaatatcacatcccaatgctcaactac-ctgatttttaagaagctcaaaatagt 153  Q
    |||| ||| ||||||||||   |||||||| || ||||||| | |||||||||||||| ||  ||||||||| |||||||||||||||    
503808 atttcgtgattgtttggtttggtggtgggaacaaaaatatcgcgtcccaatgctcaaccactgtgatttttatgaagctcaaaatagt 503721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 31; Significance: 0.00000001; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 68 - 153
Target Start/End: Complemental strand, 32274531 - 32274445
Alignment:
68 tttagtggttgtttggttctatggtgggagcacaaatatcacatcccaatgctcaactacc-tgatttttaagaagctcaaaatagt 153  Q
    ||||||||||||||||||   | |||| | || ||||||||| |||||||||||||||||| || |||||| ||| ||| |||||||    
32274531 tttagtggttgtttggtttggtcgtggaaacaaaaatatcacgtcccaatgctcaactaccgtggtttttatgaaactcgaaatagt 32274445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 29; Significance: 0.0000002; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 88 - 159
Target Start/End: Complemental strand, 34785091 - 34785019
Alignment:
88 atggtgggagcacaaatatcacatcccaatgctcaactacc-tgatttttaagaagctcaaaatagtggcttt 159  Q
    |||||||||||| ||||| ||| |||||||||| | ||||| |||||||| ||||||| ||||| || |||||    
34785091 atggtgggagcataaataccacttcccaatgctaatctaccgtgatttttgagaagcttaaaattgtagcttt 34785019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University