View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2472R-Insertion-9 (Length: 150)
Name: NF2472R-Insertion-9
Description: NF2472R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2472R-Insertion-9 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 138; Significance: 2e-72; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 138; E-Value: 2e-72
Query Start/End: Original strand, 9 - 150
Target Start/End: Complemental strand, 20520148 - 20520007
Alignment:
| Q |
9 |
tgggtgagggtgggttttgtaaggggaataagccgaatcaggttacggttgtttgtgtgctttcggcttgtggtcatggtggtatgcttcagcttgggaa |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
20520148 |
tgggtgagggtgggttttgtaaggggaataagccgaatcaggttacggttgtttgtgtgctttcagcttgtggtcatggtggtatgcttcagcttgggaa |
20520049 |
T |
 |
| Q |
109 |
atggatacatggttatgtttatagacatgggtttgtagttga |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20520048 |
atggatacatggttatgtttatagacatgggtttgtagttga |
20520007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University