View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2473_high_25 (Length: 242)
Name: NF2473_high_25
Description: NF2473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2473_high_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 170 - 225
Target Start/End: Original strand, 26991865 - 26991920
Alignment:
| Q |
170 |
cgagtggtctgtaacgtggaatccgcgggaaagataaccaaatgtcgggagttttt |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26991865 |
cgagtggtctgtaacgtggaatccgcgggaaagataaccaaatgtcgggagttttt |
26991920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University