View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2473_high_25 (Length: 242)

Name: NF2473_high_25
Description: NF2473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2473_high_25
NF2473_high_25
[»] chr4 (1 HSPs)
chr4 (170-225)||(26991865-26991920)


Alignment Details
Target: chr4 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 170 - 225
Target Start/End: Original strand, 26991865 - 26991920
Alignment:
170 cgagtggtctgtaacgtggaatccgcgggaaagataaccaaatgtcgggagttttt 225  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26991865 cgagtggtctgtaacgtggaatccgcgggaaagataaccaaatgtcgggagttttt 26991920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University