View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2473_high_31 (Length: 226)
Name: NF2473_high_31
Description: NF2473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2473_high_31 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 42983841 - 42983622
Alignment:
| Q |
1 |
tcttgaggatgattgtcacattgtcatggatggtggtcactggatgannnnnnnnatcattacttagccttgtaatgttggacattagagtttgcttccc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
42983841 |
tcttgaggatgattgtcacattgtcatggatggtggtcactggatgattttttttatcattacttagccttgcaatgttggacattagagtttgcttccc |
42983742 |
T |
 |
| Q |
101 |
ccaacggctaagattgatcaaacaatgatttggatacattttccggtattgaatgtgttttattataacaacgtgtgaataggaagatttgattgggttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
42983741 |
ccaacggctaagattgatcaaacaatgatttggatacattttccggtattgaatgtgttttattataacaacgtctgaataggaagatttgattgggttt |
42983642 |
T |
 |
| Q |
201 |
gtatccaaattgatatgaac |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
42983641 |
gtatccaaattgatatgaac |
42983622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University