View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2473_low_20 (Length: 273)
Name: NF2473_low_20
Description: NF2473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2473_low_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 16 - 260
Target Start/End: Complemental strand, 31141855 - 31141607
Alignment:
| Q |
16 |
ggatattcaaaacttgacaaggcttagggtttatgcacactctgatgatacttatttctgtttttaattgtcttggttcactgcgaaggtaatgttaatt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
31141855 |
ggatattcaaaacttgacaaggcttagggtttatgcacactctgatgatacttatttctgtttttaattgtcttggttcattgcgaaggtaatgttaatt |
31141756 |
T |
 |
| Q |
116 |
tagtcaggttatagaatcagttagttgtccacaagttctaattcaaatgnnnnnnnntgccgaaattgtcttggttcattgctttgcaactttctcnnnn |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31141755 |
tagtcaggttatagaatcagttagttgtccacaagtcctaattcaaatgacaaaaaatgccgaaattgtcttggttcattgctttgcaactttctctttt |
31141656 |
T |
 |
| Q |
216 |
nnnactattcaat----tcaataataatcatgatccatattcagtattc |
260 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
31141655 |
tttactattcaattcaatcaataataatcatgatccatattcagtattc |
31141607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University