View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2473_low_21 (Length: 269)
Name: NF2473_low_21
Description: NF2473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2473_low_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 7 - 252
Target Start/End: Complemental strand, 4412068 - 4411823
Alignment:
| Q |
7 |
tagattatacttacggatggaggaaattctgaaacatccaatcacgtagaacggaaacagatctttctggcaagcccctttggggcctccataactgatc |
106 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4412068 |
tagataatacttacggatggaggaaattctgaaacatccaatcacgtagaacggaaacagatctttctggcaagcccctttggggcctccataactgatc |
4411969 |
T |
 |
| Q |
107 |
tttccttttcaactgttgaagagcccattgcttttgaatgaatgaagtttcaacagataattccttatcctcttctgaccatgaactgttaaaatttgat |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4411968 |
tttccttttcaactgttgaagagcccattgcttttgaatgaatgaagtttcaacagataattccttatcctcttctgaccatgaactgttaaaatttgat |
4411869 |
T |
 |
| Q |
207 |
cccatggaaagaatatgtttgctaatcctctctctcaagtccttat |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4411868 |
cccatggaaagaatatgtttgctaatcctctctctcaagtccttat |
4411823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University