View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2473_low_22 (Length: 258)
Name: NF2473_low_22
Description: NF2473
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2473_low_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 17 - 239
Target Start/End: Complemental strand, 17804383 - 17804164
Alignment:
| Q |
17 |
aatatcagtaatttcataacaaaagaaagaaaagggaaatgcatataaataatataatattttaaacattggtgagaagctgagattaatttgcagacca |
116 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17804383 |
aatagcagtaatttcataacaaaagaaagaaaagggaaatacatataattaatataatattttaaacattggtgagaagctgagattaatttgcagacca |
17804284 |
T |
 |
| Q |
117 |
gtctccaatctttgttgtaggatcaggaaaacctcattaattttcacagatttaggtcaaacatagaaaaaacaaatatttatatcagtagaatccatta |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || | ||||||||||||||||||||||||| |
|
|
| T |
17804283 |
gtctccaatctttgttgtaggatcaggaaaacctcattaattttcacagatttaggtcaaacaaaggcta---cgatatttatatcagtagaatccatta |
17804187 |
T |
 |
| Q |
217 |
gtcttttcacgagtcccttcacc |
239 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
17804186 |
gtcttttcacgagtcccttcacc |
17804164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University