View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2474_high_4 (Length: 215)
Name: NF2474_high_4
Description: NF2474
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2474_high_4 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 32 - 82
Target Start/End: Complemental strand, 3834339 - 3834289
Alignment:
| Q |
32 |
cgtgaagcacaaccgttactggaaacagtatattgtgacatttttgaattc |
82 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
3834339 |
cgtgaagcacaactgttactggaaacagtatattgtgacattttcgaattc |
3834289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 22 - 75
Target Start/End: Original strand, 29034630 - 29034683
Alignment:
| Q |
22 |
atctctcttacgtgaagcacaaccgttactggaaacagtatattgtgacatttt |
75 |
Q |
| |
|
||||||| ||||||||||||||| |||||| || ||||||||||| |||||||| |
|
|
| T |
29034630 |
atctctcctacgtgaagcacaactgttactagacacagtatattgcgacatttt |
29034683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 170 - 200
Target Start/End: Complemental strand, 3834201 - 3834171
Alignment:
| Q |
170 |
tgtgacaattagaatgaatgaaatgatgttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
3834201 |
tgtgacaattagaatgaatgaaatgatgttt |
3834171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 22 - 76
Target Start/End: Original strand, 52268740 - 52268794
Alignment:
| Q |
22 |
atctctcttacgtgaagcacaaccgttactggaaacagtatattgtgacattttt |
76 |
Q |
| |
|
||||||| ||||||||||||||| |||||| || ||||||||||||||||||||| |
|
|
| T |
52268740 |
atctctcctacgtgaagcacaactgttactagacacagtatattgtgacattttt |
52268794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 22 - 75
Target Start/End: Complemental strand, 7349072 - 7349019
Alignment:
| Q |
22 |
atctctcttacgtgaagcacaaccgttactggaaacagtatattgtgacatttt |
75 |
Q |
| |
|
||||||| ||||||||||||||| |||||| || |||||||||||||||||||| |
|
|
| T |
7349072 |
atctctcctacgtgaagcacaactgttactagacacagtatattgtgacatttt |
7349019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University