View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2474_low_4 (Length: 215)

Name: NF2474_low_4
Description: NF2474
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2474_low_4
NF2474_low_4
[»] chr6 (3 HSPs)
chr6 (32-82)||(3834289-3834339)
chr6 (22-75)||(29034630-29034683)
chr6 (170-200)||(3834171-3834201)
[»] chr1 (1 HSPs)
chr1 (22-76)||(52268740-52268794)
[»] chr5 (1 HSPs)
chr5 (22-75)||(7349019-7349072)


Alignment Details
Target: chr6 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 32 - 82
Target Start/End: Complemental strand, 3834339 - 3834289
Alignment:
Q  32 cgtgaagcacaaccgttactggaaacagtatattgtgacatttttgaattc 82  Q
    ||||||||||||| |||||||||||||||||||||||||||||| ||||||    
T  3834339 cgtgaagcacaactgttactggaaacagtatattgtgacattttcgaattc 3834289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 22 - 75
Target Start/End: Original strand, 29034630 - 29034683
Alignment:
Q  22 atctctcttacgtgaagcacaaccgttactggaaacagtatattgtgacatttt 75  Q
    ||||||| ||||||||||||||| |||||| || ||||||||||| ||||||||    
T  29034630 atctctcctacgtgaagcacaactgttactagacacagtatattgcgacatttt 29034683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 170 - 200
Target Start/End: Complemental strand, 3834201 - 3834171
Alignment:
Q  170 tgtgacaattagaatgaatgaaatgatgttt 200  Q
    |||||||||||||||||||||||||||||||    
T  3834201 tgtgacaattagaatgaatgaaatgatgttt 3834171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 22 - 76
Target Start/End: Original strand, 52268740 - 52268794
Alignment:
Q  22 atctctcttacgtgaagcacaaccgttactggaaacagtatattgtgacattttt 76  Q
    ||||||| ||||||||||||||| |||||| || |||||||||||||||||||||    
T  52268740 atctctcctacgtgaagcacaactgttactagacacagtatattgtgacattttt 52268794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 22 - 75
Target Start/End: Complemental strand, 7349072 - 7349019
Alignment:
Q  22 atctctcttacgtgaagcacaaccgttactggaaacagtatattgtgacatttt 75  Q
    ||||||| ||||||||||||||| |||||| || ||||||||||||||||||||    
T  7349072 atctctcctacgtgaagcacaactgttactagacacagtatattgtgacatttt 7349019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University