View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2475_low_17 (Length: 345)
Name: NF2475_low_17
Description: NF2475
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2475_low_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 86; Significance: 5e-41; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 157 - 242
Target Start/End: Complemental strand, 18917536 - 18917451
Alignment:
| Q |
157 |
caaaaaatagttagcaacattgtgcgtgctctatcagattttgtggaaatagaatcacaagataaagttcagttgagtgtctctgc |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18917536 |
caaaaaatagttagcaacattgtgcgtgctctatcagattttgtggaaatagaatcacaagataaagttcagttgagtgtctctgc |
18917451 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University