View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2476_high_11 (Length: 228)
Name: NF2476_high_11
Description: NF2476
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2476_high_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 141; Significance: 4e-74; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 20 - 160
Target Start/End: Original strand, 29090856 - 29090996
Alignment:
| Q |
20 |
ctttacacatgtatgatgagttggatttttggaagcttctgattatgaatgagaggtattattattgtttgcaagagtaaatatggagaaaaatgtgagt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29090856 |
ctttacacatgtatgatgagttggatttttggaagcttctgattatgaatgagaggtattattattgtttgcaagagtaaatatggagaaaaatgtgagt |
29090955 |
T |
|
| Q |
120 |
acttttcacataaatggaggaggatcaccccactaccattg |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29090956 |
acttttcacataaatggaggaggatcaccccactaccattg |
29090996 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 69 - 109
Target Start/End: Original strand, 29085179 - 29085219
Alignment:
| Q |
69 |
tgagaggtattattattgtttgcaagagtaaatatggagaa |
109 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
29085179 |
tgagtggtattattattgtttgaaagagtaaatatggagaa |
29085219 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University