View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2476_low_9 (Length: 239)
Name: NF2476_low_9
Description: NF2476
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2476_low_9 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 76 - 239
Target Start/End: Original strand, 35297576 - 35297739
Alignment:
| Q |
76 |
cttctatcaaatactataaacaaaaaattcaaacaaagttttttgagggataagctattgataacgataaaaagaaaacgatataaattatcgctgaatt |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35297576 |
cttctatcaaatactataaacaaaaaattcaaacaaagttttttgagggttaagctattgataacgataaaaagaaaacgatataaattatcgctgaatt |
35297675 |
T |
|
| Q |
176 |
gtgaaaataattcaagcagatgctttgacataatttaagaagaatgggtactgtcttccgcctc |
239 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
35297676 |
gtgaaaataattcaagcagatcctttgacataatttaagaagaatgggcactgtcttccccctc |
35297739 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University