View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2479_high_112 (Length: 250)

Name: NF2479_high_112
Description: NF2479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2479_high_112
NF2479_high_112
[»] chr7 (1 HSPs)
chr7 (19-138)||(35450182-35450301)


Alignment Details
Target: chr7 (Bit Score: 112; Significance: 1e-56; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 19 - 138
Target Start/End: Complemental strand, 35450301 - 35450182
Alignment:
19 gtctagttataatttagctatcctttttccatgtgcagagtttaaccatacagttgtagtacaaaattggggaaattagtttagtttgtgtcctccccaa 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35450301 gtctagttataatttagctatcctttttccatgtgcagagtttaaccatacagttgtagtacaaaattggggaaattagtttagtttgtgtcctccccaa 35450202  T
119 aaccctttatgcaagatatg 138  Q
    ||||||||||  ||||||||    
35450201 aaccctttatcaaagatatg 35450182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University