View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2479_high_112 (Length: 250)
Name: NF2479_high_112
Description: NF2479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2479_high_112 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 112; Significance: 1e-56; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 19 - 138
Target Start/End: Complemental strand, 35450301 - 35450182
Alignment:
| Q |
19 |
gtctagttataatttagctatcctttttccatgtgcagagtttaaccatacagttgtagtacaaaattggggaaattagtttagtttgtgtcctccccaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35450301 |
gtctagttataatttagctatcctttttccatgtgcagagtttaaccatacagttgtagtacaaaattggggaaattagtttagtttgtgtcctccccaa |
35450202 |
T |
|
| Q |
119 |
aaccctttatgcaagatatg |
138 |
Q |
| |
|
|||||||||| |||||||| |
|
|
| T |
35450201 |
aaccctttatcaaagatatg |
35450182 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University