View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2479_high_121 (Length: 248)

Name: NF2479_high_121
Description: NF2479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2479_high_121
NF2479_high_121
[»] chr3 (1 HSPs)
chr3 (1-241)||(30885575-30885815)


Alignment Details
Target: chr3 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 30885575 - 30885815
Alignment:
1 tgatctctataatcttgacaggctaaaaatgttatgtgaatcaaaattgtgcgaagaaatcaatactgagaccgtagccacaacacttgccctggctgag 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||    
30885575 tgatctctataatcttgacaggctaaaaatgttatgtgaatcaaaattgtgtgaagaaatcaatactgagaccgtagccacgacacttgccctggctgag 30885674  T
101 caacaccattgtccacagctcaagacgatctgtttgaaatttattgcaaatccgacaaatttgggaggtgcgtgctattgcatgttattgtttgtacaat 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30885675 caacaccattgtccacagctcaagacgatctgtttgaaatttattgcaaatccgacaaatttgggaggtgcgtgctattgcatgttattgtttgtacaat 30885774  T
201 gtttctgatgatactgcaggggtttgatttgatagtataat 241  Q
    |||||||||||||||||||||||||||||||||||||||||    
30885775 gtttctgatgatactgcaggggtttgatttgatagtataat 30885815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University