View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2479_high_124 (Length: 245)
Name: NF2479_high_124
Description: NF2479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2479_high_124 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 43 - 245
Target Start/End: Complemental strand, 33289695 - 33289493
Alignment:
| Q |
43 |
agcaaacaattgtgattgttttgttgaaaggattacacggatgattttatttgttaaagtaaaagtagctcatttcatccaaactaattataatgagtag |
142 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| ||||||| |||| |
|
|
| T |
33289695 |
agcaaacaattgtgattgttttgttgaaaggattacacggatgattttatttgttgaagtaaaagtagctcatttcatctaaactaaatataatgtgtag |
33289596 |
T |
|
| Q |
143 |
gggaattaaaattattggagctagactaaaatacaacgttctaattagattatgaacaactctattaacttgcatatgaatgaaagctagatactagtgt |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
33289595 |
gggaattaaaattattggagctagactaaaatacaacgttctaattagattatgaacaactctattaacttgcatatgaatgaaagctagatactagtat |
33289496 |
T |
|
| Q |
243 |
taa |
245 |
Q |
| |
|
||| |
|
|
| T |
33289495 |
taa |
33289493 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University