View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2479_high_13 (Length: 504)
Name: NF2479_high_13
Description: NF2479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2479_high_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 267; Significance: 1e-149; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 1 - 308
Target Start/End: Complemental strand, 10048043 - 10047730
Alignment:
| Q |
1 |
acatggatgtgatgacaaatatgttctctactgtaatttgattttaaacaaaagaacgcaagatttacaagaaaacattagaggtaaagaatcaattgag |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10048043 |
acatgcatgtgatgacaaatatgttctctactgtaatttgattttaaacaaaagaacgcaagatttacaagaaaacattagaggtaaagaatcaattgag |
10047944 |
T |
 |
| Q |
101 |
aaatcagacgaactgggataaatatttatggcactgaattctacttagattgtcctgcagatacacagacatgatatcatctccctacctagaaactata |
200 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10047943 |
aaatcagacacactgggataaatatttatggcactgaattctacttacattgtcctgcagatacacagacatgatatcatctccctacctagaaactata |
10047844 |
T |
 |
| Q |
201 |
tactgctggtgtaggaccatacaccgaattcttgtcacgtgact------tcatacagccgagtacataattttgctttggctcggctcaatatgttggc |
294 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10047843 |
tactgctggtataggaccatacaccgaatccttgtcacgtgactcaccaatcatacagccgagtacataattttgctttggctcggctcaatatgttggc |
10047744 |
T |
 |
| Q |
295 |
gtgattaactcttt |
308 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
10047743 |
gtgattaactcttt |
10047730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 458 - 489
Target Start/End: Complemental strand, 10047734 - 10047703
Alignment:
| Q |
458 |
tcttttattatgcatggttggaccatcatatt |
489 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
10047734 |
tcttttattatgcatggttggaccatcatatt |
10047703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University