View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2479_high_132 (Length: 238)
Name: NF2479_high_132
Description: NF2479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2479_high_132 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 18 - 226
Target Start/End: Original strand, 19567935 - 19568143
Alignment:
| Q |
18 |
ggtttcacaagattactattgtttcatatcaaaagtaaggattgcatgaatgtgacacgtaacatatgaagtgacacttatctgttttctctaaggttgt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19567935 |
ggtttcacaagattactattgtttcatatcaaaagtaaggattgcatgaatgtgacacgtaacatatgaagtgacacttatctgttttctctaaggttgt |
19568034 |
T |
 |
| Q |
118 |
aatgtgaccaatgttgcttttgttactattatcactgtgtgtcactacagattgaagatgctttattttcttccatttaaaataatgcctagagaatcat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| || |||||||| |||||||||||| |
|
|
| T |
19568035 |
aatgtgaccaatgttgcttttgttactattatcactgtgtgtcactacagattgaagatgctttcttttcttccaatttaaataatggctagagaatcat |
19568134 |
T |
 |
| Q |
218 |
gagaataat |
226 |
Q |
| |
|
||||||||| |
|
|
| T |
19568135 |
gagaataat |
19568143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University