View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2479_high_141 (Length: 231)
Name: NF2479_high_141
Description: NF2479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2479_high_141 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 13 - 229
Target Start/End: Complemental strand, 56189005 - 56188789
Alignment:
| Q |
13 |
atactccctctcaacatcaagggttgcaacaccaagtagtcgctttaaagcaattgcaacagtgaatttcattggattttctaatcaagttggtaactgc |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
56189005 |
atactccctctcaacatcaagggttgcaacaccaagtagtcgctttaaagcaattgcaacagtgaatttcattggattttctaattaagttggtaactgc |
56188906 |
T |
 |
| Q |
113 |
atttggagcagcaattgccaaccccttaataaatggtcttcacacttaatttaattagtgtcccatcgtccccagtcatttcaggcttactagtctcata |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
56188905 |
atttggagcagcaattgccaaccccttaataaaaggtcttcaaacttaatttaattagtgtcccatcgtccccagtcatttcaggcttactagcctcata |
56188806 |
T |
 |
| Q |
213 |
ggcgggtacattacaaa |
229 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
56188805 |
ggcgggtacattacaaa |
56188789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 18 - 154
Target Start/End: Original strand, 2392258 - 2392392
Alignment:
| Q |
18 |
ccctctcaacatcaagggttgcaacaccaagtagtcgctttaaagcaattgcaacagtgaatttcattggattttctaatcaagttggtaactgcatttg |
117 |
Q |
| |
|
||||||||||||| |||||| |||| |||||||||||| |||||| |||| ||| | ||||||| ||||||| |||| ||||| ||||| || || |
|
|
| T |
2392258 |
ccctctcaacatc--gggttgtaacagtgagtagtcgctttgtagcaatcgcaagagtagaattcattgcattttctcatcaggttggcaactgtatctg |
2392355 |
T |
 |
| Q |
118 |
gagcagcaattgccaaccccttaataaatggtcttca |
154 |
Q |
| |
|
||||||||| |||||||||||||| || |||||||| |
|
|
| T |
2392356 |
gagcagcaagtgccaaccccttaactaaaggtcttca |
2392392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University