View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2479_high_21 (Length: 455)
Name: NF2479_high_21
Description: NF2479
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2479_high_21 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 387; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 387; E-Value: 0
Query Start/End: Original strand, 7 - 450
Target Start/End: Complemental strand, 13087994 - 13087545
Alignment:
| Q |
7 |
ggagcagagagacgacaacgatcaatgataacactgaggttatagggtgcaacatctttggcaagccactcatcaacatagaagatggtttgggaacaag |
106 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
13087994 |
ggagcagtgagacgacaacgatcaatgataacactgaggttatagggtgcaacatctttggcaagccactgatcaacatagaagatggtttgggaacaag |
13087895 |
T |
|
| Q |
107 |
gtttgtggggaccagtggaggtgacctccacgtagtcgcagtaccacccatggtggtacccagatccgtctgaggcgaggttgaggcggcaaacacgtga |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13087894 |
gtttgtggggaccagtggaggtgacctccacgtagtcgcagtaccacccatggtggtacccagatccgtctgaggcgaggttgaggcggcaaacacgtga |
13087795 |
T |
|
| Q |
207 |
tttgatgcatggtccacgtccggtgaaggcatccacatttccgcgctcgaagtagttatgaccttctcccattgcaccccatgattttaggtttgggatc |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13087794 |
gttgatgcatggtccacgtccggtgaaggcatccacatttccacgctcgaagtagttatgaccttctcccattgcaccccatgattttaggtttgggatc |
13087695 |
T |
|
| Q |
307 |
catactgattggttctttgcatcgtcgaatctaatgctgatttttgaatctgttcctcctttgatgattgatccagtctttacatatagcgtgtatacgc |
406 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
13087694 |
cacactgattggttctttgcatcgtcgaatctaatgctgattttcgaatctgttccacctttgatgattgatccagtctttacatatattgtgtatacgc |
13087595 |
T |
|
| Q |
407 |
actcctatttgcat------tcatcatcattaacaacaaaaacaaatata |
450 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
13087594 |
actcctatttgcattcatattcatcatcattaacaacaaaaacgaatata |
13087545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University